Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2020 Aug;105(8):e389-e394.
doi: 10.3324/haematol.2019.229211. Epub 2019 Nov 21.

Comparing the two leading erythroid lines BEL-A and HUDEP-2

Deborah E Daniels  1   2 , Damien J Downes  3 , Ivan Ferrer-Vicens  1 , Daniel C J Ferguson  1 , Belinda K Singleton  2   4 , Marieangela C Wilson  1 , Kongtana Trakarnsanga  5 , Ryo Kurita  6 , Yukio Nakamura  7 , David J Anstee  2   4 , Jan Frayne  8   2
Affiliations
Free PMC article

Comparing the two leading erythroid lines BEL-A and HUDEP-2

Deborah E Daniels et al. Haematologica. 2020 Aug.
Free PMC article

Erratum in

  • Erratum to: Comparing the two leading erythroid lines BEL-A and HUDEP-2.
    Daniels DE, Downes DJ, Ferrer-Vicens I, Ferguson DCJ, Singleton BK, Wilson MC, Trakarnsanga K, Kurita R, Nakamura Y, Anstee DJ, Frayne J. Daniels DE, et al. Haematologica. 2024 Jan 1;109(1):364. doi: 10.3324/haematol.2023.284510. Haematologica. 2024. PMID: 38186343 Free PMC article. No abstract available.
No abstract available

PubMed Disclaimer

Figures

Figure 1.
Figure 1.
Improved erythroid differentiation of HUDEP-2 in Bristol erythroid culture system, and comparison of BEL-A and HUDEP-2 differentiation. (A) Schematic of approaches for establishing the BEL-A and HUDEP-2 cell lines., Erythroid 1° medium consists of IMDM with 3% human AB serum, 2% fetal bovine serum, insulin, heparin, holo-transferrin, SCF, IL-3 and EPO. SS: Stemspan™ SFEM; SCF: stem cell factor; IL-3: interleukin-3; EPO: erythropoietin; DEX: dexamethasone; DOX: doxycycline. (B) Cumulative fold expansion (i), % enucleation per total live cells (ii) and reticulocyte yield (iii) of BEL-A and HUDEP-2 in Bristol differentiation media and HUDEP-2 in EDM media. Live cell numbers were determined by trypan blue exclusion assay. Enucleation rates were calculated from cytospin counts (≥200 cells per slide). Reticulocyte yield was calculated by multiplying % enucleation by cumulative fold expansion for each time point. Results are mean ± standard deviation (SD) from at least three independent experiments. */♦P<O.05, **/♦♦P<0.01, ***/♦♦♦P<0.001, ****/♦♦♦♦P<0.0001 two-tailed Student t-test comparing HUDEP-2 in Bristol with HUDEP-2 in EDM media (♦), or BEL-A with HUDEP-2 in Bristol media (*). (C) Percentage of erythroid cell types present at day 0, 4, 6, 8 and 12 of differentiation for BEL-A and HUDEP-2 in Bristol differentiation media, and HUDEP-2 in EDM media. Cells were stained with Leishman’s and ≥200 cells counted per cytospin. Data show mean ± SD, n=3, and (D) representative images from cytospins of these cultures. Scale bar =20 μm. Arrow heads represent the following cell types: white, proerythroblast; blue, basophilic normoblasts; orange, polychromatic normoblasts; black, orthochromatic normoblasts; red, reticulocytes. (E) Relative proportion of erythroid cell types present at day 8 and 12 of differentiation for BEL-A and HUDEP-2 in Bristol differentiation media, and HUDEP-2 in EDM media, presented as extrapolated cell number. (F) Flow cytometry analysis of cell surface marker expression of BEL-A and HUDEP-2 in Bristol differentiation media. Cells were dual stained with anti-CD36 or anti-α4-integrin FITC conjugates (both Miltenyi Biotec) and anti-band 3 (BRIC71) or anti-glycophorin A (GPA) (BRIC256) primary antibodies (both IBGRL, Filton) used in conjunction with an IgG1 APC secondary (Biolegend). (G) Cell surface expression of band 3, α4-integrin, GPA and CD36 of BEL-A and HUDEP-2 nucleated cells (as determined by Hoechst staining) during erythroid differentiation, presented as median fluorescence intensity (MFI). Data show mean ± SD, n=4. (H) Cell surface expression of α4-integrin, CD36 and CD71 of BEL-A and HUDEP-2 orthochromatic normoblasts at day 11 of erythroid culture, presented as median fluorescence intensity (MFI). Data show mean ± SD, n=4.
Figure 2.
Figure 2.
Globin subunit expression by BEL-A and HUDEP-2. (A). Western blots of lysates obtained from late stage (day 10) HUDEP-2 in EDM media, HUDEP-2 and BEL-A in Bristol media and adult peripheral blood (PB; day 17) erythroid cells incubated with antibodies to α-, β- and γ-globin (sc-514378; sc-21757; sc-21756; all Santa Cruz). (B) Analysis of α-, β- and γ-globin mRNA levels in BEL-A and HUDEP-2 in Bristol media on day 6 of culture by quantitative PCR (qPCR). Target gene expression was normalised to PABPC1 reference gene (using the 2-DDCt method) and compared to a BEL-A control sample. Results are means ± standard deviation (SD), n=4. TaqMan gene expression assays used were: HBA (Hs00361191_g1), HBB (Hs00747223_g1), HBG (Hs00361131_g1) and PABPC1 (Hs00743792_s1) (Fisher Scientific). (C) H3K27ac chromatin immunoprecipitation (ChIP) was carried out in 5×106 day 4 cells by fixing in 1% formaldehyde and performing immunoprecipitation (IP) with the ChIP Assay Kit (Merck Millipore) using 0.3 mg anti-H3K27ac (ab4729; Abcam). Enrichment at the HBG1/2 promoters (i) and control regions (ii) was determined using qPCR by comparing to a background control (hg19, chr16:6,002,736-6,002,834). Bars depict mean and standard deviation for IP from four separate differentiations (circles). *Mann-Whitney rank sum P=0.0286 (D-E) Response of BEL-A and HUDEP-2 cells to hydroxyurea treatment. Hydroxyurea (H8627; Sigma) was added to cells at 50 μM every two days from four days prior to the start of differentiation until harvesting of cells on day 10 of differentiation. (D) Representative Western blot of cell lysates from ± hydroxyurea (HU) cultures incubated with antibodies to α-, β- and γ-globin and (E) densitometric analysis of the bands obtained from at least three independent experiments normalised to α-globin expression (means ± SD). *P<0.05 two-tailed Student t-test. (F-G) Expression of BCL11A, GATA1 and KLF1 by BEL-A and HUDEP-2. β-actin was used as a protein loading control. (F) Representative western blots of lysates obtained from cells at day 0, 2, 4 and 6 of BEL-A and HUDEP-2 cultures incubated with BCL11A (ab19487; Abcam), GATA1 (sc-266; Santa Cruz), KLF1 (sc-14034; Santa Cruz) and β-actin (A1978; Sigma) antibodies, and (G) densitometric analysis of the bands obtained from two independent experiments normalised to β-actin expression and then compared to BEL-A day 0 (means ± SD).
Figure 3.
Figure 3.
Analysis of clonal variability in the BEL-A and HUDEP-2 cell lines. To generate clonal sub-populations of BEL-A and HUDEP-2 a BD FACSAria Cell Sorter was used to isolate single cells from the propidium iodide-negative population into 96-well plates. Single-cell clones were cultured for seven days before selecting five derived from each line at random for further characterisation (B1-B5 and H1-H5 from BEL-A [A] and HUDEP-2 [B] respectively). (i) Reticulocyte yield of BEL-A and HUDEP-2 clones compared to the respective unsorted cell line. (ii) Flow cytometry analysis of band 3 and α4-integrin expression during differentiation of BEL-A and HUDEP-2 cell lines and clonal populations. (iii-v) Globin subunit expression of BEL-A and HUDEP-2 clones. (iii) Western blots of lysates obtained from cells at day 10 of differentiation incubated with antibodies to α-, β- and γ-globin. (iv) qPCR at day 4 of differentiation with primers: HBA for GAGGCCCTGGAGAGGATGTTCC rev ACAGCGCGTTGGGCATGTCGTC; HBB for GCTCACCTGGACAACCTCAR rev CGTTGCCCAGGAGCCTGAA; HBG for TGGGTCATTTCACAGAGGAGR rev TAGACAACCAGGAGCCTTCC; PABPC1 for AGCTGTTCCCAACCCTGTAATC rev GGATAGTATGCAGCACGGTTCTG. Globin mRNA levels were normalised to respective PABPC1 mRNA level of sample. Upper and lower panels show relative HBB/HBA and HBG/HBA mRNA level to that of respective unsorted line. Right-hand panel shows average HBB and HBG mRNA levels for all BEL-A or HUDEP-2 samples. HU-2=HUDEP-2. (v) Reversed-phase high-performance liquid chromatography (RP-HPLC) of BEL-A and HUDEP-2 cells and clonal populations at day 10 of differentiation. The injection peak is identified along with peaks for β-globin (β), Gγ-globin (Gγ), α-globin (α) and Aγ-globin (Aγ); δ-globin expression is below the detection limit. A sample of erythroid cells differentiated from cord blood CD34+ at 21 day in culture is included as a positive control for γ-globin. Method was as Loucari et al. with the exception of the injection size (600,000 cells in 30 μL dH2O) and the LC column used (Jupiter 5 μm C18 300A, size 250×4.4 mm, protected with a Security Guard analytical guard system [KJ0-4282, Phenomenex]).
See this image and copyright information in PMC

References

    1. Anstee DJ, Gampel A, Toye AM. Ex-vivo generation of human red cells for transfusion. Curr Opin Hematol. 2012;19(3):163–169. - PubMed
    1. Dias J, Gumenyuk M, Kang H, et al. Generation of red blood cells from human induced pluripotent stem cells. Stem Cells Dev. 2011;20(9):1639–1647. - PMC - PubMed
    1. Trakarnsanga K, Wilson MC, Griffiths RE, et al. Qualitative and quantitative comparison of the proteome of erythroid cells differentiated from human iPSCs and adult erythroid cells by multiplex TMT labelling and nanoLC-MS/MS. PLoS One. 2014;9(7):e100874. - PMC - PubMed
    1. Kurita R, Suda N, Sudo K, et al. Establishment of immortalized human erythroid progenitor Ccell lines able to produce enucleated red blood cells. PLoS One. 2013;8(3):e59890. - PMC - PubMed
    1. Trakarnsanga K, Griffiths RE, Wilson MC, et al. An immortalized adult human erythroid line facilitates sustainable and scalable generation of functional red cells. Nat Commun. 2017;8(1):14750. - PMC - PubMed

Publication types