Atypical myeloproliferative neoplasm with concurrent BCR-ABL1 fusion and CALR mutation: A case report and literature review

Abstract

Rationale: Concurrent calreticulin (CALR) mutation and BCR-ABL1 fusion are extremely rare in chronic myelogenous leukemia; to date, only 12 cases have been reported.

Patient concerns: A 57-year-old male who had an 11-year history of essential thrombocytosis presented to our hospital with leukocytosis and marked splenomegaly for 3 months.

Diagnoses: Chronic myelogenous leukemia with myeloid fibrosis arising on the background of essential thrombocytosis harboring both BCR-ABL1 fusion and type-1 like CALR mutation.

Interventions: Imatinib was started at 300 mg daily and increased to 400 mg daily after 3 months; interferon was added after 12 months.

Outcomes: Partial cytogenetic response was achieved after 3 months of imatinib therapy and complete cytogenetic response was achieved after 1 year of treatment. However, CALR mutation was still present with a stable mutational allele burden.

Lessons: In this case report and review of additional 12 cases with simultaneous presence of CALR-mutation and BCR-ABL1 fusion, we highlighted the importance of integrating clinical, morphological, and molecular genetic data for classifying atypical myeloid neoplasms.

Figure 1

. Clinicopathological features of atypical myeloproliferative neoplasm with BCR-ABL1 fusion and calreticulin (CALR) mutation. (A) Bone marrow aspiration and Wright–Giemsa staining. The patient was admitted into our hospital and underwent bone marrow aspiration with Wright–Giemsa staining. The data show enlarged megakaryocytes and hyperlobulated nuclei, but not classical “dwarf” morphology in megakaryocytes (original magnification, ×400). (B) Hematoxylin and eosin staining of the bone marrow biopsy specimen. The patient was followed up in 2017, and bone marrow biopsy was repeated. Hematoxylin and eosin staining shows leukocytosis and severe marrow fibrosis (original magnification, ×400). (C) Karyotyping of the bone marrow. The data show 46,XX,t[9;22](q34;q11)[10]. (D) Sanger sequencing. The bone marrow was subjected to polymerase chain reaction (PCR) using the primers 5′-GTGGGGCGTAACAAAGGTGA-3′ and 5′-AGAGACATTATTTGGCGCGG-3′ and Sanger sequencing. The data show a frameshift mutation of CALR exon 9 hotspot (c.1182-1215delaaggaggaggaagaagacaagaaacgcaaagagg, p.L368fs^∗51). (E) Graphic depiction of peripheral blood counts from 2006 to January 2019. The patient was treated initially with interferon after acute myocardial infarction from 2007 to 2017, and the platelet count was sustained around 400 to 600 × 109/L. In October 2017, he was switched to imatinib due to chronic myeloid leukemia based on leukocytosis, splenomegaly, and BCR-ABL1 fusion. After 3 months of imatinib treatment, thrombocytosis had worsened even though the BCR-ABL1 transcript levels markedly decreased. To control the platelet count, the patient was given a combination of imatinib with interferon. (F) Quantitative reverse-transcriptase (qRT)-PCR. The bone marrow samples were subjected to qRT-PCR (the top table) and next-generation DNA sequencing (the bottom table). The qRT-PCR data show the level of BCR-ABL fusion transcript as an international standard value, whereas the bottom table shows the allele burden of CALR mutation.