RT-qPCR Testing of SARS-CoV-2: A Primer

Abstract

Testing for the presence of coronavirus is an essential diagnostic tool for monitoring and managing the current COVID-19 pandemic. The only reliable test in current use for testing acute infection targets the genome of SARS-CoV-2, and the most widely used method is quantitative fluorescence-based reverse transcription polymerase chain reaction (RT-qPCR). Despite its ubiquity, there is a significant amount of uncertainty about how this test works, potential throughput and reliability. This has resulted in widespread misrepresentation of the problems faced using this test during the current COVID-19 epidemic. This primer provides simple, straightforward and impartial information about RT-qPCR.

Keywords: COVID-19; SARS; pandemic; real-time fluorescence PCR; reverse transcription.

Figure 1

Thermal profile of a typical RT-qPCR test run on a BioRad CFX qPCR instrument. Here, the RT step is carried out at 50 °C for 15 min, followed by a 3-min RT deactivation and Taq polymerase activation step. The RT is followed by the PCR phase, which consists of a 5 s denaturation step, during which the DNA strands separate into single strands, and a 45 s 60 °C annealing/polymerisation incubation step, during which the amplification primers (and detection probes) hybridise to the single-stranded DNA templates and allow the polymerase to replicate the template, creating double-stranded DNA. During successful polymerisation, the probe is displaced and hydrolysed, separating fluorophore and quencher and releasing fluorescence. This process is repeated, usually around 40 times (40 cycles). A typical RT-qPCR run, as exemplified here, is completed in around 1 h 27 min. As this is a RT-qPCR run, quantification is achieved by measuring the intensity of fluorescence signals at the end of each cycle to deduce the amount of PCR product generated.

Figure 2

Signal generation during a RT-qPCR test. Test reagents include a buffer, both enzymes, target-specific DNA primers, and a target-specific DNA probe that is labelled at one end with a fluorescent label and at the other with a quencher. Samples on the left and right contain the same primers and probe, but the one on the left harbours target RNA, whereas the one on the right does not. A. RT: Samples are incubated at around 50 °C, which results in the RT transcribing target-specific cDNA from one of the strand-specific primers on the left, with no reverse transcription on the right. B. Denaturation: Samples are heated to 95 °C, which denatures the RNA but leaves the cDNA intact. C. Annealing: the temperature is lowered to around 60 °C, with the actual temperature assay-dependent. This allows both the target-specific primers and probe to bind to their respective targets on the left, whereas primers and probe remain unbound on the right. D. Polymerisation: this step may be combined with the annealing step. On the left, the polymerase extends DNA synthesis, initially from one primer only, but after the first cycle from both, and displaces and hydrolyses any bound probe. This separates fluorophore and quencher and results in the emission of light if the fluorophore is excited at the appropriate wavelength. On the right, none of this occurs, and no light is emitted. This first cycle is followed by a further, user-defined number of cycles, indicated by the stippled arrow leading back to step B. E. Amplification plots obtained for each sample track the increasing emission of light characteristic of a positive result from the sample on the left (green plot), whereas the sample with no amplifiable target on the right records no light emission and a negative result (red plot).

Figure 3

Amplification of SARS-CoV-2 using a fluorescence-based RT-qPCR assay. A. Thermal profile of a typical fast RT-qPCR test. The RT step can be carried out at a range of temperatures, here Superscript IV at 55 °C, for different lengths of time, here 2 min. A polymerase activation step deactivates the RT and activates Taq polymerase, here SensiFast (Bioline), with the time dependent on which polymerase is being used. PCR cycling steps in this example are 40 cycles at 95 °C (denaturation) and 1 s at 60 °C (annealing/polymerisation), allowing the RT-qPCR run to be completed in around 17 min. As this is a RT-qPCR run, at the end of each cycle fluorescence intensity is read to establish the amount of PCR product generated. B. Amplification plot generated using the above protocol, with the assay run as a duplicate RT-qPCR using OneStep (PCRBio) kit. The primer and probe sequences were (5′-3′) F: GGATCAAGAATCCTTTGGTGG; R: GTCACAAAATCCTTTAGGATTTGGA; Probe: FAM-. CATCGTGTTGTCTGTACTGCCGTTGCC-BHQ.