Biallelic PDE2A variants: a new cause of syndromic paroxysmal dyskinesia

Abstract

Cause of complex dyskinesia remains elusive in some patients. A homozygous missense variant leading to drastic decrease of PDE2A enzymatic activity was reported in one patient with childhood-onset choreodystonia preceded by paroxysmal dyskinesia and associated with cognitive impairment and interictal EEG abnormalities. Here, we report three new cases with biallelic PDE2A variants identified by trio whole-exome sequencing. Mitochondria network was analyzed after Mitotracker™ Red staining in control and mutated primary fibroblasts. Analysis of retrospective video of patients' movement disorder and refinement of phenotype was carried out. We identified a homozygous gain of stop codon variant c.1180C>T; p.(Gln394*) in PDE2A in siblings and compound heterozygous variants in young adult: a missense c.446C>T; p.(Pro149Leu) and splice-site variant c.1922+5G>A predicted and shown to produce an out of frame transcript lacking exon 22. All three patients had cognitive impairment or developmental delay. The phenotype of the two oldest patients, aged 9 and 26, was characterized by childhood-onset refractory paroxysmal dyskinesia initially misdiagnosed as epilepsy due to interictal EEG abnormalities. The youngest patient showed a proven epilepsy at the age of 4 months and no paroxysmal dyskinesia at 15 months. Interestingly, analysis of the fibroblasts with the biallelic variants in PDE2A variants revealed mitochondria network morphology changes. Together with previously reported case, our three patients confirm that biallelic PDE2A variants are a cause of childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy.

Fig. 1. Pedigree and chromatograms of genomic DNA sequence of biallelic variations in PDE2A patients reported in this study.

a Pedigree of Patient #1 who was confirmed by Sanger sequencing to be homozygous for the c.1180C>T; p.(Gln394*) nonsense variant and both parents being heterozygous. b Pedigree and Sanger sequencing of Patient #3 showing heterozygous compound variation. c missense variant c.446C>T; p.(Pro149Leu) herited from the unaffected father and d splice site variant c.1922+5G>A inherited from the unaffected mother. Reads from exome sequence data are shown with Sanger sequences. Circles represent female participants and squares male participants. Black symbols indicate affected patients. Arrows indicate the proband.

Fig. 2. In silico experimental data for the biallelic PDE2A variants in Patient #3.

a Multiple-sequence alignment showing the highly conserved Pro140 amino acid in the protein sequence encoded by the missense mutation c.446C>T; p.(Pro149Leu). b Bioinformatics analyses predicting a drastic decrease in the efficiency of the canonical donor splice site predicted to lead to exon 22 skipping. c Schematic representation of RT-PCR (primer sequence used for RT-PCR: EX21F1:5′CCACATGAAGGTCTCCGATG3′–EX23R1:5′GAGTTGTTTGTGCCTCTGTG3′) and nested PCR: Ex21-23F2:5′GCTGCCATTGACTCCAATTT3′–Ex24R2:5′CCTCGAGGTAGTTGGTGAGC3′) to evidence exon 22 skipping. d Sanger sequencing chromatograms of the amplified fragment confirming exon 22 skipping. e 1% gel electrophoresis initial RT-PCR products (left panel) and nested PCR products showing the amplification of the predicted fragment of about 184 bp only in the patient (blood: middle panel and fibroblast: right panel) bearing the variant and not in the control individual.

Fig. 3. Mitochondrial morphology differs between control and affected cells.

a Fibroblasts from non-affected (ctrl) individuals and from Patient #3 and #1 were grown on coverslips stained with Mitotracker™ Red CMXRos and DAPI. and observed by fluorescence microscopy. A mitochondrial phenotype corresponding to thicker, more irregular mitochondrial filaments was observed in Patient #3 and #1 cells. 9X zoom of the boxed region is displayed to allow a more detailed observation of the mitochondrial network. b Cells presenting abnormal mitochondrial network were counted in three independent experiments encompassing 100 cells each. The mean of the three experiments was calculated and significance determined using a T test, **p < 0.001.

Fig. 4. Patient #2 EEG recording at the age of 4 months.

a Tonic symmetric contractions during awakening on EMG (arrow) with corresponding pattern of spasm on EEG. b Focal right seizure associating loss of contact, stretching of the arms, ocular revulsion, and left head deviation with rhythmic right discharge on EEG (arrow). c Intercritic awakening activity with multifocal epileptic pseudoperiodic spikes.