A ligation and restriction enzyme independent cloning technique: an alternative to conventional methods for cloning hard-to-clone gene segments in the influenza reverse genetics system

Abstract

Background: Reverse genetics is used in many laboratories around the world and enables the creation of tailor-made influenza viruses with a desired genotype or phenotype. However, the process is not flawless, and difficulties remain during cloning of influenza gene segments into reverse genetics vectors (pHW2000, pHH21, pCAGGS). Reverse genetics begins with making cDNA copies of influenza gene segments and cloning them into bi-directional (pHW2000) or uni-directional plasmids (pHH21, pCAGGS) followed by transfection of the recombinant plasmid(s) to HEK-293 T or any other suitable cells which are permissive to transfection. However, the presence of internal restriction sites in the gene segments of many field isolates of avian influenza viruses makes the cloning process difficult, if employing conventional methods. Further, the genetic instability of influenza gene-containing plasmids in bacteria (especially Polymerase Basic 2 and Polymerase Basic 1 genes; PB2 and PB1) also leads to erroneous incorporation of bacterial genomic sequences into the influenza gene of interest.

Methods: Herein, we report an easy and efficient ligation and restriction enzyme independent (LREI) cloning method for cloning influenza gene segments into pHW2000 vector. The method involves amplification of megaprimers followed by PCR amplification of megaprimers using a bait plasmid, DpnI digestion and transformation.

Results: Hard-to-clone genes: PB2 of A/chicken/Bangladesh/23527/2014 (H9N2) and PB1 of A/chicken/Bangladesh/23527/2014 (H9N2), A/chicken/Jiangxi/02.05YGYXG023-P/2015 (H5N6) and A/Chicken/Vietnam/H7F-14-BN4-315/2014 (H9N2) were cloned into pHW2000 using our LREI method and recombinant viruses were subsequently rescued.

Conclusion: The LREI cloning procedure represents an alternative strategy for cloning influenza gene segments which have internal restriction sites for the enzymes used in reverse genetics. Further, the problem of genetic instability in bacteria can be alleviated by growing recombinant bacterial cultures at a lower temperature. This technique can be applied to clone any influenza gene segment using universal primers, which would help in rapid generation of influenza viruses and facilitate influenza research and vaccine development.

Keywords: Influenza; Polymerase; Restriction enzyme independent cloning; Reverse genetics.

Fig. 1

A schematic representation of the LREI cloning procedure. The technique involves designing primers that incorporate the gene specific untranslated region (UTR) (yellow) and nucleotides homologous to the plasmid pHW2000 (red) multiple cloning site (MCS) to the polymerase coding region resulting in formation of a megaprimer. The viral RNA extracted from the influenza virus (1) can be reverse transcribed by using universal 12 primers (AGCAAAAGCAGG) (2), and the megaprimer can be amplified either from cDNA or any donor plasmid using the primers mentioned in Table 1 (3). Denaturation of the megaprimer generates two primers having complementary ends to the pHW2000 MCS, which when used with a bait plasmid facilitate annealing (4,5). Subsequent thermocycling steps result in extension of the annealed primers (5) thereby synthesizing the non-methylated DNA insert along with the pHW2000 vector as a mixture. DpnI treatment results in digestion of parental methylated DNA, (7) leaving the newly synthesized non-methylated DNA, which can be transformed into E. coli resulting in formation of the desired recombinant plasmid (8)

Fig. 2

The PB1 positive colonies of Bangladesh/2014 and Vietnam/2014 H9N2 virus were screened by plasmid PCR using the PB1 primers [31]. Out of 16 colonies screened for Bangladesh PB1 (lane 1–16), 3 were positive (13, 14, 15; indicated by arrows) while for 9 colonies screened for Vietnam PB1 (lane 17–25), 4 were found to be positive (22, 23, 24, 25; indicated by arrows). The positive clones were further confirmed by nucleotide sequencing using T7F and BGHR primers. (+ = positive control; M = DNA marker)

Fig. 3

The PB2 positive colonies of Bangladesh/2014 H9N2 virus were screened by plasmid PCR using the PB2 primers [31]. Out of 47 colonies screened (lane 1–47) for Bangladesh/2014 PB2, 7 were positive in plasmid PCR (indicated by arrows). The positive clones were further confirmed by nucleotide sequencing using T7F and BGHR primers. (+ = positive control; M = DNA marker)

Fig. 4

The PB1 colonies of Jiangxi/2015 were screened by colony PCR. A portion of 550 bp of PB1 was amplified using the primers H5N6 PB1F (GAAGTTGGGGGGGAGCGAAAGCAGGC) and H5N6 PB1-R (CATCACATCCTTGAGGAAATCTATTAG). Eight colonies were screened by colony PCR. The positive colonies in colony PCR (indicated by arrows) were further confirmed by plasmid PCR and nucleotide sequencing using T7F and BGHR primers (+ = positive control; M = DNA marker)