First Report of CRISPR/Cas9 Mediated DNA-Free Editing of 4CL and RVE7 Genes in Chickpea Protoplasts

Abstract

The current genome editing system Clustered Regularly Interspaced Short Palindromic Repeats Cas9 (CRISPR/Cas9) has already confirmed its proficiency, adaptability, and simplicity in several plant-based applications. Together with the availability of a vast amount of genome data and transcriptome data, CRISPR/Cas9 presents a massive opportunity for plant breeders and researchers. The successful delivery of ribonucleoproteins (RNPs), which are composed of Cas9 enzyme and a synthetically designed single guide RNA (sgRNA) and are used in combination with various transformation methods or lately available novel nanoparticle-based delivery approaches, allows targeted mutagenesis in plants species. Even though this editing technique is limitless, it has still not been employed in many plant species to date. Chickpea is the second most crucial winter grain crop cultivated worldwide; there are currently no reports on CRISPR/Cas9 gene editing in chickpea. Here, we selected the 4-coumarate ligase (4CL) and Reveille 7 (RVE7) genes, both associated with drought tolerance for CRISPR/Cas9 editing in chickpea protoplast. The 4CL represents a key enzyme involved in phenylpropanoid metabolism in the lignin biosynthesis pathway. It regulates the accumulation of lignin under stress conditions in several plants. The RVE7 is a MYB transcription factor which is part of regulating circadian rhythm in plants. The knockout of these selected genes in the chickpea protoplast using DNA-free CRISPR/Cas9 editing represents a novel approach for achieving targeted mutagenesis in chickpea. Results showed high-efficiency editing was achieved for RVE7 gene in vivo compared to the 4CL gene. This study will help unravel the role of these genes under drought stress and understand the complex drought stress mechanism pathways. This is the first study in chickpea protoplast utilizing CRISPR/Cas9 DNA free gene editing of drought tolerance associated genes.

Keywords: 4-coumarate ligase (4CL); CRISPR/Cas9; DNA free gene editing; Reveille 7 (RVE7); chickpea; drought stress; protoplast.

Figure 1

Graphical abstract: An overview of the CRISPR/Cas9 DNA free gene editing in the chickpea protoplast. The protoplasts of young leaves were isolated and transformed with CRISPR RNP complex under optimum conditions. The DNA was extracted from the protoplast control and test samples and sent for Sanger sequencing to detect the mutations. The transformation efficiency and knockout score were identified using ICE bioinformatics tool (Synthego).

Figure 2

Systematic design to show the location of sgRNA target sites in RVE7 and 4CL nucleotide sequences. (a) Systematic illustration of the nucleotide sequence of RVE7 gene locus. (b) Systematic diagram of the nucleotide sequence of 4CL gene locus. The blue boxes represent exons and orange connecting lines represent introns.

Figure 3

Results of in vitro digestion cleavage assay of both sgRNA sets for 4CL and RVE7 gene. (a) sgRNA 1 for 4CL and RVE7. The DNA of 5 kb PCR-amplified fragments for gene 4CL and RVE7 were treated with preassembled RNPs (sgRNAs (crRNA/tracrRNA) + Cas9) and in vitro cleavage assay was performed. For in vitro cleavage assay non-treated samples were used as negative controls in gel electrophoresis. (b) sgRNA 2 for 4CL and RVE7. The digested samples for 4CL left side and RVE7 at right side. Above lane 2,3,4 correspond to 4Cl and lane 6,7,8 for RVE7 samples. The expected band size for sgRNA 1 RVE7 were approximately 2298 and 3543; sgRNA 2 4469 and 1363. For 4CL the expected band sizes after digestion for sgRNA1 were 4931 and 1170; sgRNA 2 approximately 4477 and 1428.

Figure 4

Flow chart of the steps performed during the protoplast isolation from leaf tissue of chickpea plants. The leaves from the 4 to 5 weeks old plants were collected and surface sterilized. The leaves were cut into small pieces. The enzyme solution was prepared and cut leaf sections were kept in the dark for 4 to 5 h digestion resulting in protoplast formation. After 2 h, samples for protoplast formation were collected to check the protoplast formation stage, and once the protoplast were isolated, they were used for the PEG mediated transfections.

Figure 5

Illustration of ICE Analysis of RVE7 sgRNA1 (GTGGAGGATTGAATGTAAGACGG) RNP complex edited protoplast cells in chickpea. The respective protoplast samples were edited and sequenced with Sanger sequencing (Macrogen, Seoul, Korea) and further analyzed with the ICE (Synthego, Redwood City, CA, USA) online tool to deconvolute the pooled protoplast DNA. The contributions show the sequences inferred in the edited protoplast population and their relative proportions. The “+” sign is for the wild type sample. The target cut sites are denoted by black vertical dotted lines. The trace plots for the edited samples below show the cut site and protospacer adjacent motif (PAM) sequence labelled in the edited sample and control sample. The sgRNA 2 sequencing samples had low quality before the cut site and could not be analyzed using the ICE tool.

Figure 6

Traces of the edited and control population of the protoplast as shown by the Sanger Scheme 1. files control and the experimental study, which contain mixed base call. The region underlined in horizontal black represents the guide sequence. The PAM site is represented as the horizontal red focus. The vertical dotted black line represents the site of the actual break. Cutting and fixing which is sensitive to errors usually results in mixed sequencing bases after cutting.

Figure 7

ICE results for 4CL. (a) The sequence plot represents the ICE Analysis of 4CL sgRNA1 Target 1 (sgRNA:CCAATGAACTAGACGGTGACATA) RNP edited protoplast cells in the chickpea. The contributions show the sequences inferred in the edited protoplast population and their relative proportions. The cut sites are represented by black vertical dotted lines and “+” far left side denotes the control sample. (b) The trace plot of the 4CL sample 4 edited and control population of the protoplast showing the PAM sequence and cut site.