Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1988 Feb 11;16(3):833-47.
doi: 10.1093/nar/16.3.833.

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides

F Morvan  1 , B Rayner, J P Leonetti, J L Imbach
Affiliations
Free PMC article

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides

F Morvan et al. Nucleic Acids Res. .
Free PMC article

Abstract

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.

PubMed Disclaimer

References

    1. Nucleic Acids Res. 1980 Nov 25;8(22):5473-89 - PubMed
    1. Antiviral Res. 1987 Sep;8(2):55-70 - PubMed
    1. Nucleic Acids Res. 1985 Feb 25;13(4):1173-84 - PubMed
    1. Proc Natl Acad Sci U S A. 1986 Mar;83(5):1227-31 - PubMed
    1. Proc Natl Acad Sci U S A. 1986 May;83(9):2787-91 - PubMed

Publication types

MeSH terms

Substances