Reactive astrocytes as treatment targets in Alzheimer's disease-Systematic review of studies using the APPswePS1dE9 mouse model

Abstract

Astrocytes regulate synaptic communication and are essential for proper brain functioning. In Alzheimer's disease (AD) astrocytes become reactive, which is characterized by an increased expression of intermediate filament proteins and cellular hypertrophy. Reactive astrocytes are found in close association with amyloid-beta (Aβ) deposits. Synaptic communication and neuronal network function could be directly modulated by reactive astrocytes, potentially contributing to cognitive decline in AD. In this review, we focus on reactive astrocytes as treatment targets in AD in the APPswePS1dE9 AD mouse model, a widely used model to study amyloidosis and gliosis. We first give an overview of the model; that is, how it was generated, which cells express the transgenes, and the effect of its genetic background on Aβ pathology. Subsequently, to determine whether modifying reactive astrocytes in AD could influence pathogenesis and cognition, we review studies using this mouse model in which interventions were directly targeted at reactive astrocytes or had an indirect effect on reactive astrocytes. Overall, studies specifically targeting astrocytes to reduce astrogliosis showed beneficial effects on cognition, which indicates that targeting astrocytes should be included in developing novel therapies for AD.

Keywords: AD mouse model; APPswePS1dE9; Alzheimer's disease; amyloid-beta; reactive astrocytes.

FIGURE 1

An overview of the amyloidogenic and non‐amyloidogenic pathway, the generation of the APPswePS1dE9 mouse model, and gliosis. (a) Alternative processing of APP by α‐, β‐, and/or γ‐secretases resulting in amyloidogenic and non‐amyloidogenic cleavage. (b) Humanized mouse APP sequence (the white blocks indicate the human‐specific amino acids that were introduced in the mouse sequence), containing the Swedish mutation (yellow block). (c) PS1 is a transmembrane protein and part of the γ‐secretase complex. The PS1dE9 mutation results in the deletion of exon 9. (d) The APPswe and PS1dE9 transgenes were integrated in MoPrP vectors between exon 2 and 3; the coding sequence of PrP was completely removed, as described in Borchelt et al. (1996) and Jankowsky et al. (2001). The two vectors were co‐injected into a single cell embryo derived from F2 hybrids of C57BL/6J and C3H/HeJ mice: C3/B6HeJ mice. This resulted in the generation of double transgenic APPswePS1dE9 mice, in which the expression of both the APP and the PS1 gene is driven by the mouse prion protein promoter. (e) Integration of the transgenes occurred at chromosome 9 between the Arpp21 and Pdcd6ip genes (Jackson et al., 2015). (f) From the age of 6 months, reactive astrocytes (GFAP, green) and activated microglia (Iba1, red) surrounding Aβ plaques (6E10, blue) were detected, scale bar: 50 μm, adjusted from original picture in Orre et al. (2014). Aβ, amyloid‐beta; APP, amyloid precursor protein; ε‐site, epsilon cleavage site; GFAP, glial fibrillary acidic protein; Iba1, ionized calcium‐binding adapter molecule 1; MoPrP, modified prion protein; PrP, prion protein; PS1, presenilin 1; sAPPα, soluble amyloid precursor protein‐α; sAPPβ, soluble amyloid precursor protein‐β. Based on Jackson et al. (2015) and Jankowsky et al. (2001, 2007). Scientific illustration toolkits from Motifolio were used to generate parts of this figure

FIGURE 2

Endogenous and transgenic APP and PS1 expression in astrocytes and microglia. (a). Expression levels of endogenous APP and PS1, modified from https://web.stanford.edu/group/barres_lab/brain_rnaseq.html. Cells were isolated from the cortices of P7 mice (Zhang et al., 2014). (b,c) Cortical astrocytes and microglia were isolated from 15‐ to 18‐month‐old WT (blue) and APPswePS1dE9 mice (red) by FACS procedures, described in detail by Orre et al. (2014). RNA was isolated using TRIsure and cDNA was generated following the manufacturer's instructions (Quantitect – Qiagen). Resulting cDNA served as a template in real‐time qPCR assays (SYBR Green PCR Master Mix; Applied Biosystems), as described by Kamphuis et al. (2015). To determine expression levels of the humanized APP (hAPP) transgene the following primers were used: FW: TGAACCATTTCAACCGAGCTG and REV: GTGGGTACCTCCAGAGCC. Transcript levels were normalized to HPRT and GAPDH levels. (b) Normalized mRNA expression of hAPP is higher in astrocytes of APPswePS1dE9 mice (n = 17 mice) compared to WT (n = 20 mice, the level of hAPP was below the limit of detection in 17 samples). (c) Normalized mRNA expression of hAPP is higher in microglia of APPswePS1dE9 mice (n = 19 mice) compared to WT (n = 33 mice, the level of hAPP was below the limit of detection in 29 samples). (d,e) Cortical astrocytes and microglia were isolated from 4‐month‐old wild‐type (blue) and APPswePS1dE9 mice (red) by MACS procedures, adapted from protocol by Orre, Kamphuis, Osborn, Melief, et al. (2014). To determine expression levels of the hPS1 transgene the following primers were used: FW: GAGGACAACCACCTGAGCAA and REV: ATCTTGCTCCACCACCTGC. Transcript levels were normalized to HPRT and GAPDH levels. (d) Normalized mRNA expression of hPS1 is higher in astrocytes of APPswePS1dE9 mice (n = 4 mice) compared to WT (n = 4 mice, the level of hPS1 was below the limit of detection in three samples). (e) Normalized mRNA expression of hPS1 is higher in microglia of APPswePS1dE9 mice (n = 4 mice) compared to WT (n = 4 mice, the level of hPS1 was below the limit of detection in three samples). FACS, fluorescence‐activated cell sorting; FPKM, fragments per kilobase million; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; hAPP, humanized amyloid precursor protein; HPRT, hypoxanthine phosphoribosyltransferase; hPS1, human presenilin 1; MACS, magnetic‐activated cell sorting; MO, myelinating oligodendrocyte; NFO, newly formed oligodendrocyte; OPC, oligodendrocyte progenitor cell; PS1, presenilin 1; WT, wild‐type. *p < .05, ****p < .0001, Mann–Whitney test

FIGURE 3

Flowchart of study selection. Refer to Section 4 for the search terms used in the first search