Multiplex T-cell Stimulation Assay Utilizing a T-cell Activation Reporter-based Detection System

Abstract

Immune tolerance and response are both largely driven by the interactions between the major histocompatibility complex (MHC) expressed by antigen presenting cells (APCs), T-cell receptors (TCRs) on T-cells, and their cognate antigens. Disordered interactions cause the pathogenesis of autoimmune diseases such as type 1 diabetes. Therefore, the identification of antigenic epitopes of autoreactive T-cells leads to important advances in therapeutics and biomarkers. Next-generation sequencing methods allow for the rapid identification of thousands of TCR clonotypes from single T-cells, and thus there is a need to determine cognate antigens for identified TCRs. This protocol describes a reporter system of T-cell activation where the fluorescent reporter protein ZsGreen-1 is driven by nuclear factor of activated T-cells (NFAT) signaling and read by flow cytometry. Reporter T-cells also constitutively express additional pairs of fluorescent proteins as identifiers, allowing for multiplexing of up to eight different reporter T-cell lines simultaneously, each expressing a different TCR of interest and distinguishable by flow cytometry. Once TCR expression cell lines are made they can be used indefinitely for making new T-cell lines with just one transduction step. This multiplexing system permits screening numbers of TCR-antigen interactions that would otherwise be impractical, can be used in a variety of contexts (i.e., screening individual antigens or antigen pools), and can be applied to study any T-cell-MHC-antigen trimolecular interaction.

Keywords: Antigens; Epitopes; Fluorescent protein markers; Multiplex assay; NFAT; Reporter; T-cell receptors; T-cell stimulation.

Figure 1.. Principle of the assay – strategy of reporter T-cell generation.

Four vectors for making TCR expression cell lines are transduced into 5KC α-β- cells (T-hybridoma cells lacking endogenous TCR expression). The first vector contains the NFAT-binding sequence followed by the fluorescent ZsGreen-1 gene, and the human CD8 co-receptor gene driven by the PGK promoter. The second vector encodes the Murine CD3. The third and fourth vectors contain fluorescent protein (FP) genes as identifiers. The TCR expression cell line is then transduced with a vector encoding TCR alpha and beta chain genes to generate functional TCR reporter cells. When the TCR reporter cell is activated upon the recognition of a peptide presented by an antigen presenting cells (APC), NFAT transcription factor proteins bind to the NFAT-binding site and promote the ZsGreen-1 gene expression, which is detected by flow cytometry. By using 8 combinations of FP identifiers, mixtures of 8 different TCRs can by assayed in the same reaction well.

Figure 2.. Procedure workflow.

The protocol proceeds in four major steps. The first step generates TCR expression cells lines that are then used in step 2 to make TCR reporter cell lines. Step 3, generating APC cell lines, can be done concurrently with steps 1 and 2. In step 4, the multiplex stimulation assay is performed, using the TCR reporter lines co-cultured with APC cells and antigens. Flow cytometry is used to measure ZsGreen-1 expression in positively stimulated cells.

Figure 3.. 8xNFAT-ZsG-hCD8 reporter vector.

A. Schematic diagram of the 8xNFAT-ZsG construct. The 8xNFAT-ZsG reporter construct consists of 8 repeats of NFAT binding sites (GGAGGAAAAACTGTTTCATACAGAAGGCGT), a TATA box, and the ZsGreen-1 gene. B. Plasmid map of 8xNFAT-ZsG-hCD8. The 8xNFAT-ZsG-hCD8 reporter vector backbone has BspEI and HindIII restriction enzyme sites that can be used to remove the hCD8α-P2A-hCD8β gene construct. A TCR co-receptor gene fragment containing sequences overlapping the linearized vector ends can then be inserted by Gibson assembly. C. Schematic diagram of the hCD8α-P2A-hCD8β gene construct. Sequences for hCD8α and hCD8β genes (maroon) are joined by P2A (pink). The portion of PGK promoter (white) excised when the vector is digested with BspEI is restored by addition to the 5’ end of hCD8α as part of the 5’ DNA fragment end. Blue brackets indicate the positions of the 5’ and 3’ DNA fragment ends. Panel A is adapted from the article published by Mann et al. (2020) in Frontiers in Immunology (doi 10.3389/fimmu.2020.00633), which is licensed under by CC BY 4.0 (https://creativecommons.org/licenses/by/4.0/). The sequence of the vector is also available in Mann et al. (2020) .

Figure 4.. CD3-2A_pMI-LO vector.

A. Plasmid map of CD3-2A_pMI-LO. Locations of the murine CD3 subunits (green), IRES (grey), and LO FP gene (orange) are shown. Restriction enzyme sites MfeI and HpaI can be used to excise the IRES-FP gene cassette. B. Schematic diagram of the DNA fragment with IRES-FP gene fragment insert and flanking vector sequence. Blue brackets indicate the vector-overlapping DNA fragment ends added to the FP gene sequence. IRES excised with the original FP gene is replaced as a DNA segment added to the 5’ end of the new FP gene fragment.

Figure 5.. Fluorescent Protein Vectors.

A. Plasmid map of pMSCVII-mChe (pMSCV-mChe). B. Plasmid map of pMSCVII. C. Schematic diagram of DNA fragment with FP gene sequence and flanking vector sequence (black line). EcoRI and XhoI restriction enzyme sites are indicated by arrows, and positions of the DNA fragment end vector-overlapping sequences by blue brackets.

Figure 6.. TCR vectors.

A. Plasmid maps for MBC1-null and MBC2-null. Each vector contains murine TRAV signal peptide sequence and either murine β constant region TRBC1*01 (MBC1-null) or TRBC2*03 (MBC2-null) in an MSCV-based retroviral vector. The multi-cloning site (SalI-BglII) is located between murine TRAV signal peptide sequence (dark pink) and the TRBC gene (light purple). B. Example plasmid map of a completed TCR vector after insertion of the 1) human V-α DNA fragment (dark purple), 2) Cα-P2A DNA fragment (light purple-light pink-dark pink), and 3) human V-α DNA fragment (dark purple). C. Schematic diagram of the TCR region inserted into the MBC2-null vector. Three DNA fragments, 1) human V-α gene segment (DNA Fragment 1; V-α), 2) the murine TRAC*01-P2A-murine TRBV signal peptide sequence (DNA Fragment 2; Cα-P2A), and 3) human V-β gene segment (DNA Fragment 3; V-β), are inserted between the murine TRAV signal peptide and murine TRBC sequences of the backbone vector.

Figure 7.. Example of a DNA fragment 1 V-α.

DNA fragment 1 starts with the last 8 codons of the murine TRAV signal peptide sequence (green, 5’ DNA fragment end sequence), immediately followed by human TRAV12-3*01 sequence (red), starting with the first codon after the signal peptide sequence, a recombination junction sequence (TC, purple), and TRAJ4*01 sequence (blue). The first nucleotide of the final TRAJ codon (T) will join the first two nucleotides of the constant region (AC, black) to make the last codon of TRAJ. These two AC nucleotides plus subsequent 9 codons of the TRAC segment (black, 3’ DNA fragment end sequence) is added to overlap with DNA fragment 2 Cα-P2A.

Figure 8.. Example of a DNA fragment 3 V-β.

DNA fragment 3 starts with the last 9 codons of the murine TRBV signal peptide sequence (green, 5’ DNA fragment end sequence), immediately followed by human TRBV2*01 sequence (red), starting with the first codon after the signal peptide sequence, a recombination junction sequence (CG, purple), and TRBJ2-5*01 sequence (blue). The first nucleotide of the final TRBJ codon (G) will join the first two nucleotides of the constant region (AG, black) to make the last codon of TRBJ. These two AG nucleotides plus the subsequent 9 codons of the TRBC segment (black, 3’ DNA fragment end sequence) is added to overlap with the linearized vector.

Figure 9.. Plasmid map for CaP2AIII_pK18.

DNA fragment 2 Cα-P2A (maroon) contains murine TRAC*01 (light purple)-P2A (light pink)-murine TRBV signal peptide sequence (dark pink), inserted between the MscI and AleI restriction digest sites of CaP2AIII_pK18.

Figure 10.. MHC Vector Construction.

A. Plasmid map of non-replicating lentiviral backbone vector pUS. A ubiquitous chromatin opening element (UCOE) precedes the spleen focus forming virus (SFFV) promoter (Adamson et al., 2016). An MluI-SbfI cloning site is located after the SFFV promoter. B. Plasmid map of an example MHC I vector, A2_uSFFV. A2_uSFFV vector was constructed by digesting the pUS backbone vector with MluI and SbfI and inserting the HLA-A*02:01 gene-P2A-human β2 microglobulin gene cassette by Gibson assembly. C. Schematic diagram of an MHC I gene-P2A-human β2 microglobulin gene cassette. D. Schematic diagram of an MHC II α gene-P2A-MHC II β gene cassette. The blue brackets indicate the positions of the 5’ and 3’ DNA fragment ends added to MHC gene sequences..

Figure 11.. Overview of the timeline and workflow to generate cell lines via transfection and transduction.

The retroviral system is shown as an example.

Figure 12.. Overview of the procedure for creating TCR-expressing NFAT-reporter 5KC α-β- cells for multiplexing.

In step 1, the hCD8-8xNFAT reporter vector (8xNFAT-ZsG-hCD8, generated in Step A2) and CD3 vectors containing either the ametrine (AM) or LSSmOrange (LO) fluorescent protein gene (CD3-AM or CD3-LO, generated in Step A3) are co-transduced into 5KC α-β- cells. In the second step, either AM or LO fluorescent protein vectors (pMSCV-AM or pMSCV-LO) are transduced with one of four other fluorescent protein vectors (generated in Step A4). Finally, a TCR vector (generated in Step A5) is added to the cells containing the 8xNFAT reporter, hCD8, CD3, and fluorescent identifiers.

Figure 13.. Schematic of plate layout for transduction with 8xNFAT-ZsG-hCD8 and CD3-LO or CD3-AM.

Note that each transduction well receives retroviral supernatants from two transduction plates. Orange arrows represent the addition of retroviral supernatant from transfected Phoenix plates to 5KC α-β- cells on transduction plate. Unused wells are filled with 3 ml phosphate-buffered saline (PBS).

Figure 14.. Example flow sorting plot for the transduction represented in Figure 13.

5KC α-β- cells transduced with 8xNFAT-ZsG-hCD8 and either CD3-LO or CD3-AM are stained with PE-labeled anti-hCD8 antibody. After gating on live cells using the FSC vs. SSC scatter plot, double positive cells (PE and AM or PE and LO) are sorted. LSSmOrange is shown in the figure as an example.

Figure 15.. Plate layout for transduction of identifying fluorescent proteins.

Note that each transduction well receives 1 ml of each retroviral supernatant from two transfection plates. Representative arrows demonstrate the addition of both pMSCV-AM and pMSCV-BFP retroviral supernatants to well A1. Underlined text at the tops of wells represents the 8xNFAT-CD3-AM and 8xNFAT-CD3-LO cell lines being transduced.

Figure 16.. Example flow sorting plot for the LO-High/BFP⁺ transduction represented in Figure 15.

LO is already present in cells as part of the CD3-LO vectors added in Step 1. pMSCV-LO is added in this step to ensure sufficient color expression. LO-High/BFP⁺ cells are collected, while LO-Low/BFP⁺ cells are discarded because they were not transduced with the pMSCV-LO vector. See notes 9 and 10 for details.

Figure 17.. Schematic of transduction plate for introducing TCRs to generate color-coded 5KC TCR reporter cells.

Underlined text represents vectors that have already been introduced to parental cells. Note that each TCR is transduced into cells with different color combinations, so that individual TCRs can be distinguished by flow cytometry.

Figure 18.. Stimulation assay workflow and plate setup.

A. Schedule of stimulation assay experiments, beginning with thawing all 5KC-TCR reporter cell lines and their corresponding K562-APC lines at day 0. Stimulation assays must be set up no earlier than 4 days and no later than 7 days after 5KC-TCR reporter cells are thawed. Stimulation assay plate should be read between 18 and 32 h after the addition of 5KC-TCR cells to ensure sufficient time for response to be mounted. B. Workflow of stimulation plate setup on Day 4. Note that if antigens are proteins, rather than short peptides, K562-APCs and antigens should be cultured overnight before adding 5KC-TCR reporter cells.

Figure 19.. Gating strategy for determining response levels of each 5KC-TCR line in a mixture.

After gating for live cells using the FSC vs. SSC scatter plot, K562-APCs can be excluded from 5KC-TCR cells by their lack of color. 5KC-TCR cells are gated on AM-positive and LO-positive cells. Within both AM and LO gating, cells are further gated for secondary color positivity (e.g., AM+ and BFP+), and ZsGreen-1 positivity is assessed based on gating determined by non-activated cell control. This figure is adapted from the article published by Mann et al. (2020) in Frontiers in Immunology (doi 10.3389/fimmu.2020.00633), which is licensed under by CC BY 4.0 (https://creativecommons.org/licenses/by/4.0/). In this example, the TCR cell line identified by AM+/BFP+ is responding positively to stimulation, as seen by the expression of ZsGreen-1 along the X axis.