Successful birth after preimplantation genetic testing for a couple with two different reciprocal translocations and review of the literature

Abstract

Background: Preimplantation genetic testing for chromosomal structural rearrangements (PGT-SR) is widely applied in couples with single reciprocal translocation to increase the chance for a healthy live birth. However, limited knowledge is known on the data of PGT-SR when both parents have a reciprocal translocation. Here, we for the first time present a rare instance of PGT-SR for a non-consanguineous couple in which both parents carried an independent balanced reciprocal translocation and show how relevant genetic counseling data can be generated.

Methods: The precise translocation breakpoints were identified by whole genome low-coverage sequencing (WGLCS) and Sanger sequencing. Next-generation sequencing (NGS) combining with breakpoint-specific polymerase chain reaction (PCR) was used to define 24-chromosome and the carrier status of the euploid embryos.

Results: Surprisingly, 2 out of 3 day-5 blastocysts were found to be balanced for maternal reciprocal translocation while being normal for paternal translocation and thus transferable. The transferable embryo rate was significantly higher than that which would be expected theoretically. Transfer of one balanced embryo resulted in the birth of a healthy boy.

Conclusion(s): Our data of PGT-SR together with a systematic review of the literature should help in providing couples carrying two different reciprocal translocations undergoing PGT-SR with more appropriate genetic counseling.

Keywords: Genetic counseling; PGT-SR; Reciprocal translocations; Translocation breakpoints; Whole genome low-coverage sequencing.

Fig. 1

Pedigree study and translocation breakpoint identification for the couple. a Pedigree of the family. b Karyotype analysis of the wife 46,XX,t(10;16)(q25.2;q12.1) and the husband 46,XY,t(9;14)(p21.1;q12). c Junction-spanning PCR with Sanger sequencing showed four precise reciprocal translocation breakpoints of the couple. WB1 = wife breakpoint 1; WB2 = wife breakpoint 2; HB1 = husband breakpoint 1; HB2 = husband breakpoint 2

Fig. 2

Summary of PGT-SR results of the couple. a NGS analysis of three trophectoderm biopsy sample. Embryo 1 and embryo 2 were detected as balanced; Embryo 3 was unbalanced. b Diagnosis of the carrier status of embryo 1 and embryo 2. Breakpoint-specific PCR were amplified using the primers WB1-F/R (F: ATTTCTTGGGTGCCCCTCTG, R: AGCATTCTTTCTCACTCATCCCA), WB2-F/R (F: GGGAAATTAGGCAACCCCAAG, R: GAGAGTCTCGCCCAAAGTCA), HB1-F/R (F: CCAATCCGACTGGTTGTGGG, R: TGTGCATGTTAAGCCCACTCT) and HB2-F/R (F: AAGTACACTCCACAGAGTGGG, R: CAGGGAGAGGCAACTTCTCAA); PCR Agarose gel showing the presence (+) or absence (−) of a PCR product for breakpoint or normal sequence; the DNA of the wife and the hasband were uesd for carrier DNA positive controls; a normal DNA was uesd for noncarrier DNA positive control; M = DNA marker; WB1 = wife breakpoint 1; WB2 = wife breakpoint 2; HB1 = husband breakpoint 1; HB2 = husband breakpoint 2. c Karyotype of the fetus: 46,XY,t(10;16)(q25.2;q12.1)mat. d SNP-based CMA of the fetus

Fig. 3

Nuclear pedigrees of couples who both were reciprocal translocation carriers in the literature. Fifty out of 52 recognized pregnancies were natural pregnancies, and the twins of Family A were born through PGT-SR. The karyotypes of the offspring are labeled with “Balanced, Unbalanced or Normal”