Current Perspectives on the Role of TNF in Hematopoiesis Using Mice With Humanization of TNF/LT System

Abstract

TNF is a multifunctional cytokine with its key functions attributed to inflammation, secondary lymphoid tissue organogenesis and immune regulation. However, it is also a physiological regulator of hematopoiesis and is involved in development and homeostatic maintenance of various organs and tissues. Somewhat unexpectedly, the most important practical application of TNF biology in medicine is anti-TNF therapy in several autoimmune diseases. With increased number of patients undergoing treatment with TNF inhibitors and concerns regarding possible adverse effects of systemic cytokine blockade, the interest in using humanized mouse models to study the efficacy and safety of TNF-targeting biologics in vivo is justified. This Perspective discusses the main functions of TNF and its two receptors, TNFR1 and TNFR2, in steady state, as well as in emergency hematopoiesis. It also provides a comparative overview of existing mouse lines with humanization of TNF/TNFR system. These genetically engineered mice allow us to study TNF signaling cascades in the hematopoietic compartment in the context of various experimental disease models and for evaluating the effects of various human TNF inhibitors on hematopoiesis and other physiological processes.

Keywords: cytokine blockade; cytokines; emergency hematopoiesis; humanized mouse models; steady-state hematopoiesis.

Figure 1

Summary of TNF functions in hematopoiesis. (A) During fetal hematopoiesis in zebrafish TNF/TNFR2 signaling is required to establish HSC fate via activation of Notch and NF-kB signaling (18). (B) Bone marrow of adult TNF-deficient mice is characterized by normal LSK HSPC numbers and by an increase in Gr-1⁺ neutrophils (19). Mixed Tnf ^-/- and Tnf ^+/+ BM chimeras underrepresent TNF-deficient monocytes (20). (C) TNF may inhibit HSC expansion when cultured with SCF and G-CSF, but not in cytokine-rich medium (21). Addition of TNF to LSK cultures inhibits formation of CFU-GEMM and CFU-GM (22). TNF promotes monocytes survival (20) and inhibits proliferation and differentiation of granulocyte progenitors (19, 23, 24). Under inflammatory conditions induced by irradiation TNF may be beneficial for progenitor engraftment (25) but stromal cell-derived TNF induces ROS accumulation in HSPCs (26), and granulocyte-derived TNF is involved in vascular regeneration (27). Following immunization, TNF may suppress CXCL12-dependent retention of B cell progenitors in the bone marrow leading to their migration (28). In the case of viral infections TNF protects HSPCs from necroptosis, enhances myelopoiesis and induces apoptosis of GMP (21).

Figure 2

TNF inhibition affects immature myeloid cell development in vitro. Bone marrow cells were isolated from femurs of hTNFKI mice and cultured for 5 days in RPMI 1640 medium supplemented with L-Glutamine (2 mM), penicillin (100 U/ml), streptomycin (100 μg/ml), HEPES (10 mM), β-mercaptoethanol (50 μM), 10% FBS, GM-CSF (20 ng/ml) and IL-4 (10 ng/ml). Infliximab was added in the final concentration of 100 ng/ml. After 5 days in culture cells were stained with Fixable Viability Dye, CD11b (M1/70), Ly6C (HK1.4), Ly6G (RB6-8C5) and acquired with BD FACSCanto II flow cytometer. Data were analyzed using FlowJo software. (A) Representative FACS plots of Ly6G⁺Ly6C^low and Ly6G^-Ly6C^high cells gated on VD^-CD11b⁺ cells. (B) Frequencies of Ly6G⁺Ly6C^low and Ly6G^-Ly6C^high cells gated on VD^-CD11b⁺ cells. (C) Ly6G^-Ly6C^high cells were purified using Myeloid-Derived Suppressor Cell Isolation Kit (Miltenyi Biotec) according to the manufacturer’s protocol. RNA was isolated from purified cells using TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. RNA (1 μg) was treated with DNase I and reverse transcribed to cDNA with M-MuLV reverse transcriptase (RevertAid first strand cDNA synthesis kit, Thermo Scientific). Real-time quantitative PCR was performed using qPCRmix-HS SYBR+LowROX (Evrogen) and the following primer set: Actb, Forward: CTCCTGAGCGCAAGTACTCTGTG, Reverse: TAAAACGCAGCTCAGTAACAGTCC, Bcl2, Forward: GAGTTCGGTGGGGTCATGTG, Reverse: TATAGTTCCACAAAGGCATCCCAG, Bcl2a1a, Forward: GGCAGAATGGAGGTTGGGAAG, Reverse: ATTCTCGTGGGAGCCAAGGT, Bcl2l1, Forward: AGAGAGGCAGGCGATGAGTT, Reverse: TCCACAAAAGTGTCCCAGCC. Reactions were run using the following program on the Applied Biosystems 7500: 95°C for 10 min, 40 cycles of 95°C for 15 sec, 61°C for 30 sec and 72°C for 20 sec. Each point in a diagram represents a single mouse; mean ± SEM. *P < 0,05; **P < 0,01. Two-tailed unpaired Student’s t-test was used.