Potential Common Genetic Risks of Sporadic Parkinson's Disease and Amyotrophic Lateral Sclerosis in the Han Population of Mainland China

Abstract

Sporadic Parkinson's disease (sPD) and sporadic amyotrophic lateral sclerosis (sALS) are neurodegenerative diseases characterized by progressive and selective neuron death, with some genetic similarities. In order to investigate the genetic risk factors common to both sPD and sALS, we carried out a screen of risk alleles for sALS and related loci in 530 sPD patients and 530 controls from the Han population of Mainland China (HPMC). We selected 27 single-nucleotide polymorphisms in 10 candidate genes associated with sALS, and we performed allelotyping and genotyping to determine their frequencies in the study population as well as bioinformatics analysis to assess their functional significance in these diseases. The minor alleles of rs17115303 in DAB adaptor protein 1 (DAB1) gene and rs6030462 in protein tyrosine phosphatase receptor type T (PTPRT) gene were correlated with increased risk of both sPD and sALS. Polymorphisms of rs17115303 and rs6030462 were associated with alterations in transcription factor binding sites, secondary structures, long non-coding RNA interactions, and nervous system regulatory networks; these changes involved biological processes associated with neural cell development, differentiation, neurogenesis, migration, axonogenesis, cell adhesion, and metabolism of phosphate-containing compounds. Thus, variants of DAB1 gene (rs17115303) and PTPRT gene (rs6030462) are risk factors common to sPD and sALS in the HPMC. These findings provide insight into the molecular pathogenesis of both diseases and can serve as a basis for the development of targeted therapies.

Keywords: amyotrophic lateral sclerosis; common genetic risk; pathogenesis; polymorphism; sporadic Parkinson’s disease.

FIGURE 1

Study design and procedures. To identify common pathogenic genes between sPD and sALS, we downloaded four independent GWAS datasets from the dbGap database of the NCBI, mapped all SNPs to genic regions, and then preformed an integrative analysis to scan for common genetic factors related to sPD. We also compared the 52 candidate genes with our previous sALS data from a GWAS of the HPMC and found 23 that were significant in both sPD and sALS. We selected 27 loci in 10 related genes for validation in an independent cohort of 530 sPD patients and 530 neurologically normal control subjects at the Affiliated Hospital of Nanchang University. DAB1 rs17115303 and PTPRT rs6030462 were identified as being closely associated with both sPD and sALS. sPD, sporadic Parkinson’s disease; sALS, sporadic amyotrophic lateral sclerosis; GWAS, genome-wide association study; NCBI, National Center for Biotechnology Information; SNPs, single-nucleotide polymorphisms; HPMC, Han population of mainland China.

FIGURE 2

Gene set enrichment analysis of the four GWAS datasets. Pairwise comparisons of gene sets from four studies were performed based on p-values. (A–C) pha000004 was enriched compared with pha002840 (A), pha002865 (B), and pha003128 (C). (D,E) pha002840 was enriched compared with pha002865 (D) and pha003128 (E). (F) pha002865 was enriched compared with pha003128. These results confirm the reproducibility of the four studies and indicate that similar molecular mechanisms of sPD-related genes were found in all of the studies. GWAS, genome-wide association study; sPD, sporadic Parkinson’s disease.

FIGURE 3

Venn diagram analysis of the four GWAS datasets. There were 43,474 candidate genes with at least one genotyped locus in study 1; 44,304 candidate genes in study 2; 43,699 candidate genes in study 3; and 41,458 candidate genes in study 4. There were 2,779 overlapping candidate genes between the four datasets by Venn diagram analysis; based on a nominal threshold p-value < 0.01, we identified 52 genes that were significantly associated with sPD. GWAS, genome-wide association study; sPD, sporadic Parkinson’s disease.

FIGURE 4

NCBI gene sequence positions of DAB1 rs17115303 and PTPRT rs6030462. (A) DAB1 gene located at chr1:57194802 with a C-to-A transversion on the reverse strand. (B) PTPRT gene located at chr20:42771589 with a G-to-A transition on the reverse strand. NCBI, National Center for Biotechnology Information.

FIGURE 5

Predicted transcription factor binding sites in DAB1 rs17115303 and PTPRT rs6030462. The sequences from 100 bp upstream to 100 bp downstream of DAB1 rs17115303 and PTPRT rs6030462 were analyzed using NHRscan software. (A) The sequence from 98 to 117 of DAB1 rs17115303 was predicted as the binding site fragment (ER8: GGAGATGCGCTTTGAGGACT; red box) with a mutation at base position 4. (C) The sequence from 83 to 102 of PTPRT rs6030462 was predicted as the binding site fragment (ER8: GGAAGTGGTGCAGGCTGTCG; red box), with a mutation at base position 19. (B,D) Statistical analysis of predicted binding sites of DAB1 rs17115303 (B) and PTPRT rs6030462 (D). (E–G) Predicted transcription factor binding sites of DAB1 rs17115303 and PTPRT rs6030462 using NRHscan and Mscan software; transcription factor binding sites were predicted at 1,300–1,420 and 900–1,100 bp in the DAB1 rs17115303 binding site fragment (E,F) and at 725–531 bp in the PTPRT rs6030462 binding site fragment. The mutations in DAB1 rs17115303 and PTPRT rs6030462 were predicted to prevent transcription factor binding.

FIGURE 6

Predicted secondary structures of DAB1 rs17115303 and PTPRT rs6030462. The secondary structure of the sequence from 100 bp upstream to 100 bp downstream of DAB1 rs17115303 and PTPRT rs6030462 mutation positions were analyzed using Mfold software. (A,B) Secondary structure prediction for the introns of DAB1 rs17115303 (A) and PTPRT rs6030462 (B). The binding regions formed a hairpin structure. By overlaying observed SNPs (red triangles) and predicted binding sites (red lines) onto the secondary structure of DAB1 rs17115303 and PTPRT rs6030462, it was determined that the hairpin structure may be required for protein binding. The SNPs of both genes were located in the cap region and were predicted to destabilize the hairpin, thereby affecting splicing. SNPs, single-nucleotide polymorphisms.

FIGURE 7

Predicted lncRNA binding sites in DAB1 rs17115303 and PTPRT rs6030462. (A,B) Three lncRNAs were predicted to bind DAB1 rs17115303 (A), and 23 lncRNAs were predicted to bind PTPRT rs6030462 (B). In both cases, the lncRNAs were presumed to bind the transcriptional intron and not the DNA strand. lncRNA, long non-coding RNA.

FIGURE 8

Regulatory networks of DAB1 and PTPRT. (A,B) Nervous system regulatory networks of transcription factors binding to the promoter region of DAB1 gene (A) and PTPRT gene (B) and genes related to ALS (OMIM 105400). The red pentagon represents transcription factors; the green node represents predisposing genes; squares represent biological processes; and lines indicate the relationships between transcription factors, genes, and biological processes. ALS, amyotrophic lateral sclerosis.