Widespread in situ follicular neoplasia in patients who subsequently developed follicular lymphoma

Abstract

In situ follicular neoplasia (ISFN) is usually an occasional incidental finding in lymph nodes by BCL2 immunohistochemistry, and its true scale is unknown. We have identified six cases of follicular lymphoma (FL) with a history of solid neoplasm 4-16 years ago, from which ISFN was identified widely in the surgically cleared lymph nodes (LNs). Using clone-specific PCR and BaseScope in situ hybridisation with primers or probes specific to the VDJ or BCL2-IGHJ junction sequence, we confirmed the clonal identity among different ISFNs and overt-FL in each of the four cases successfully investigated. Mutation analyses of overt-FL by targeted next-generation sequencing identified multiple potential pathogenic changes involving CREBBP, EZH2, KMT2D, TNFRS14, and STAT6. Further investigations of these mutations in paired ISFNs using Fluidigm PCR and Illumina sequencing showed the presence of the FL-associated mutations in early lesions for two of the six cases investigated (CREBBP and KMT2D in one case and STAT6 in the other), with one case displaying stepwise accumulation of its observed mutations. Remarkably, there were considerable divergences in BCL2 variants among different ISFN-involved lymph nodes in all four cases successfully investigated, indicating ongoing intraclonal diversification by somatic hypermutation machinery. Our findings demonstrate widespread distribution of ISFN lesions, further implicating their dynamic nature with the neoplastic cells undergoing active trafficking and clonal evolution. © 2021 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of The Pathological Society of Great Britain and Ireland.

Keywords: clonal evolution; follicular lymphoma; in situ follicular neoplasia; somatic mutation.

Figure 1

The extent of ISFN involvement in lymph nodes (LNs) removed from solid neoplasia surgery. Variations of BCL2 staining in various LNs that show prominent ISFN involvement as defined above (see Figure 3 for examples). The mean and range number of follicles involved by ISFN in each case are indicated. Case F has been excluded from the analysis as the slides available for research were not evaluable. Data includes only the LNs that show prominent ISFN involvement with at least one follicle displaying clustered or diffuse BCL2 positivity, and those with minimal involvement (few scattered strong BCL2‐positive cells in a germinal centre) are not included.

Figure 2

Confirmation of clonal identity between the early in situ follicular neoplasias (ISFNs) and late overt follicular lymphoma (FL) in case A. (A) BCL2 immunohistochemistry shows multiple ISFN lesions (indicated by arrows) in one of the involved lymph nodes (left panel) and strong BCL2 staining in the neoplastic cells of ISFN (right panel). (B) IG gene rearrangement analysis by BIOMED‐2 FR2‐JH PCR demonstrates a clonal IGH rearrangement (left panel). The CDR3 sequence is shown in the bottom panel, with the sequences used for designing the clone‐specific primer and BaseScope probe indicated. The sequence encoding an N‐glycosylation motif (N‐X‐S/T) is indicated [AAT: asparagine (N); CAG: glutamine (Q); and ACC: threonine (T)]. Examples of clone‐specific PCR are illustrated in the right panel. Multiple areas containing different follicles involved by ISFN in lymph node 3 (LN3) were microdissected and analysed (ISFN‐LN3a–g). (C) BaseScope in situ hybridisation shows diffuse hybridisation signals in a malignant follicle centre of overt‐FL (left panel) and scattered positivity in the follicle centre of an ISFN (right panel). Probe binding detected as red signal. Probe targets the end of the V‐region sequence, all of the V‐D junctional sequence, and the start of the D‐region sequence: 5'‐GCGGCCGTCTATTACTGTATGACAAATCAGACCCAGGAAGA‐3'. Any adjustments to the original image contrast to improve visualisation have been applied equally across the image.

Figure 3

Confirmation of clonal identity between the early in situ follicular neoplasias (ISFNs) and late overt follicular lymphoma (FL) in case C. (A) BCL2 immunohistochemistry shows multiple ISFN lesions with strong BCL2 staining in the neoplastic ISFN cells (indicated by arrows) in one of the involved lymph nodes (top left panel), and diffuse (right panel), partial (bottom left) and scattered positivity (bottom right). (B) BCL2‐JH PCR by BIOMED‐2 assays (MBR1) shows a positive product (left panel). The BCL2‐JH fusion sequence is shown in the bottom panel, with the sequence used for designing the clone‐specific primer and BaseScope probe indicated. Examples of clone‐specific PCR are illustrated in the right panel. (C) BaseScope in situ hybridisation shows diffuse hybridisation signals in a malignant follicle centre of overt‐FL (left panel) and scattered positivity in the follicle centre of an ISFN (right panel). Probe binding detected as red signal. Probe targets the end of the BCL2 gene sequence, all of the BCL2–JH fusion sequence, and the start of the JH sequence: 5'‐AAGCAGGAAACCTGTGGTATGAAGCCGTACCCCCACACATAC‐3'. Any adjustments to the original image contrast to improve visualisation have been applied equally across the image.

Figure 4

Comparison between pathogenic and BCL2 variants identified in late overt follicular lymphoma (FL) and the matched early in situ follicular neoplasias (ISFNs). (A) Heatmap illustration of pathogenic variants identified in FL and ISFN. Left: summary of the predicted pathogenic variants identified in overt‐FL using a previously described target sequencing 70‐gene panel [12], and their detection in the ISFN‐involved LNs from the solid neoplasia surgery by Fluidigm PCR and Illumina sequencing. Grey: insertion; brown: deletion; red: stopgain; blue: missense; yellow: splicing; white: no variant detected. Right: predicted stepwise accumulation of pathogenic mutations for case A from common progenitor (CPC) to ISFN and overt‐FL. (B) Heatmap illustration of BCL2 variants identified in FL and ISFN by Fluidigm PCR and Illumina sequencing. Analyses of lymph node (LN) involved by ISFN are based on pooled microdissected ISFN lesions, and also individual follicles involved by ISFN. The variants include all sequence changes in the region of BCL2 gene sequenced from upstream of the 5'UTR to the end of the coding sequence of exon 3 (supplementary material, Table S4) and show remarkable divergence among ISFN LNs and overt‐FL. Variants were included based on cut‐off > 1% variant allele frequency and present in >5 reads in each direction for coding regions, while present in >10 reads in each direction for non‐coding regions. Blue: missense; green: synonymous SNV; red: stopgain; grey: noncoding region. Dots indicate data not available due to poor coverage.