Rare isolation of human-tropic recombinant porcine endogenous retroviruses PERV-A/C from Göttingen minipigs

Abstract

Background: Porcine endogenous retroviruses (PERVs) can infect human cells and pose a risk for xenotransplantation when pig cells, tissues or organs are transplanted to human recipients. Xenotransplantation holds great promise to overcome the shortage of human donor organs after solving the problems of rejection, functionality and virus safety. We recently described the transmission of a human-tropic recombinant PERV-A/C, designated PERV-F, from peripheral blood mononuclear cells (PBMCs) of a Göttingen Minipig (GöMP) to human 293 cells (Krüger et al., in Viruses 12(1):38, 2019). The goal of this study was to characterize PERV-F in more detail and to analyze the probability of virus isolation from other animals.

Methods: The recombination site in the envelope (env) gene, the long terminal repeats (LTR), the proteins and the morphology of the recombinant PERV-F were characterized by polymerase chain reaction (PCR), sequencing, Western blot analysis, immunofluorescence, and transmissible electron microscopy. Mitogen-stimulated PBMCs from 47 additional pigs, including 17 new GöMP, were co-cultured with highly susceptible human 293 T cells, and the PERV-A/C prevalence and PERV transmission was analyzed by PCR.

Results: PERV-F, isolated from a GöMP, is an infectious human-tropic PERV-A/C virus with a novel type of recombination in the env gene. The length of the LTR of PERV-F increased after passaging on human cells. In a few minipigs, but not in German landrace pigs, PERV-A/C were found. There was no transmission of human-tropic PERV-A/C from additional 47 pigs, including 17 GöMP, to human cells.

Conclusion: These data show that human-tropic recombinant PERV-A/C proviruses can only be found in a very small number of minipigs, but not in other pigs, and that their isolation as infectious virus able to replicate on human cells is an extremely rare event, even when using highly susceptible 293 cells.

Keywords: Copy number; Long terminal repeats; Porcine endogenous retroviruses; Recombination; Xenotransplantation.

Fig. 1

Schematic presentation of the recombination sites in the envelope gene of PERV A/C isolates. A genomic organization of PERVs, B recombination points of various PERV A/C isolates, GöMP-F, virus released from the Göttingen Minipig F, GöMP-8, virus released from the Göttingen minipig number 8. Numbers indicate the localization of the recombination site in base pairs (bp), C comparison of a short sequence in the env gene of PERV-A (Accession No. AJ293656), PERV-C (Accession No. KY352351) and PERV-A/C isolated from GöMP 8. Green indicate PERV-A, red PERV-C, blue is a 15 nt insert in PERV-F, the numbers indicate the last nt of the recombination point

Fig. 2

A Detection of a PERV-A/C provirus in untreated PBMCs from GöMP 8 and absence of PERV-A/C in the PBMCs of 16 other GöMPs. NC, negative water control. The migration of the markers is also shown. B Confirmation of the detection of an PERV-A/C provirus in untreated PBMCs from pig number 8, NC, negative water control, PC, positive control, M marker. C Detection of a PERV-A/C mRNA using primers PERV-A VRB fw and PERV-C TMR rev in DNase-treated RNA from PBMCs of pig 8, PC positive control, NC negative control

Fig. 3

PERV copy numbers in consecutive passages of human 293 cells after co-incubation of stimulated PBMCs from pig F with PHA-L. The copy number was estimated by ddPCR using porcine actin as reference gene. For comparison the PERV copy number in pig PK15 cells was analysed (green column)

Fig. 4

PERV expression in PBMCs from GöMPs F and E. A expression of PERV pol (shows the expression of all PERVs) of unstimulated PBMCs at day 0 (d0) and at day 5 after PHA stimulation (d5+) from pig F (red) compared to pig E (green). B Expression of PERV-C of unstimulated PBMCs at day 0 (d0) and at day 5 after PHA stimulation (d5+) from pig F (red) and for comparison from pig E (green). C Expression of PERV-A/C of unstimulated PBMCs at day 0 (d0) and at day 5 after PHA stimulation (d5+) from pig F (red). Error bars indicate standard error of mean, n = 3

Fig. 5

Amplification of the LTR sequences from DNA from different passages of human 293 cells infected with PERV-F. The days after start of the co-cultivation of uninfected 293 cells with mitogen-stimulated PBMCs from pig F are indicated. DNA was isolated from the cells and for amplification the primers AAAGGATGAAAATGCAACCTAACC and ACGCACAAGACAAAGACACACGAA (Czauderna et al., 2000 [45]) were used. A Results of two independent experiments on day 0, day 5 and day 40. PERV-A/C means the positive control of PERV-5⁰ [24, 25], PK15 was also used as control, B comparison of subsequent passages of PERV-F on 293 cells, M, marker, the Gene ruler 1 kb DNA ladder was used; P, DNA isolated from original PBMCs from pig F; PK15, DNA isolated from PK15 cells

Fig. 6

Schematic presentation of the repeats in the LTR of PERV-A/C. A Cell-free PERV-A/C was quickly passaged on human 293, leading to additional repeats, Denner et al., [24]. B Schematic presentation of the localization and number of repeats in LTRs isolated at different time points of co-culture of PBMCs from GöMP 8 with human 293 cells and subsequent passaging. PERV-F represents the LTR of a provirus after long-time passaging of PERV-F on 2893 cells

Fig. 7

Detection of viral proteins by Western blot analysis. A Cell lysates from 293 cells infected with PERV-F and with PERVi were analysed in 1, 1:10 and 1:100 dilution, using goat serum 62 to detect the SU-Env gp70, goat serum 30 to detect the p27Gag and goat serum 16 to detect the transmembrane envelope protein p15E. PERVi is a new infection (i) of PERV-5⁰ [24]. The sera were used 1:1000, an alkaline phosphatase conjugates donkey anti-goat serum was used 1:2000. An unstained protein ladder was used and the molecular weights in kDa were indicated with lilac arrows. B Virus pellets from supernatants of 293 cells producing PERV-F at day 52 and 65 and 293 cells producing PERVi were analysed using goat serum 62 and 30, recombinant gp70 (molecular weight 54) and recombinant p27 were used as positive control. A prestained protein ladder was used and the molecular weights in kDa were indicated with lilac arrows

Fig. 8

Immunofluorescence analysis of PERV protein expression in 293 cells infected with PERV-F. An antiserum against p27Gag was used. As control uninfected 293 were analysed

Fig. 9

Electron microscopy of PERV particles produced in 293 cells. A group of mature virions with icosahedral nucleocapsids (C-type morphology), B, C Groups of viruses with few particles showing an atypical nucleocapsid morphology (arrows) which is clearly different from the icosahedral shape of mature virions but also from the ring-like gag-protein arrangement of immature virus particles. Scale bar = 100 nm