Diverse cardiac phenotypes among different carriers of the same MYH7 splicing variant allele (c.732+1G>A) from a family

Abstract

Background: Left ventricular non-compaction cardiomyopathy (LVNC) is a rare congenital heart defect. Gene defections have been found in patients with LVNC and their family members; and MYH7 is the most frequent gene associated with LVNC.

Methods: We performed a complete prenatal ultrasound and echocardiographic examination on a fetus with cardiac abnormality and a parent-child trio whole-exome sequencing to identify the potential genetic causes. When the genetic abnormality in MYH7 was identified in the fetus, we performed echocardiography and genetic screening on its high-risk relatives.

Results: Second trimester ultrasound and echocardiography showed several malformations in the fetus: Ebstein's anomaly (EA), heart dilatation, perimembranous ventricle septal defects, mild seroperitoneum, and single umbilical artery. Heterozygous genotyping of a splicing variant allele (NM_00025.3: c.732+G>A) was identified in this fetus and her mother, not her father, indicating a maternal inheritance. Subsequently, direct sequencing confirmed the presence of this splicing variant among her grandmother (mother of mother), mother, older sister, and herself in a heterozygous manner. No PCR products were amplified by qRT-PCR for the RNA samples extracted from peripheral blood cells. In addition to this proband who was diagnosed with EA, her older sister and grandmother (mother of mother) were diagnosed with isolated asymptomatic LVCN, but her mother was just a carrier with no marked clinical manifestations after family screening.

Conclusion: The presence of MYH7 splicing variant c.732+G>A can be inherited maternally, and its cardiac phenotypes are different from one carrier to another.

Keywords: Left ventricular non-compaction; MYH7; Splice site mutation.

Fig. 1

Phenotype of the fetus: perimembranous ventricle septal defect (A); Ebstein's anomaly, left ventricular noncompaction (B). A The ventricle septal defect (arrow) was located below the aortic valve. B EA (The displacement of the septal tricuspid leaflet from the mitral valve annulus was greater than 0.3 cm); left ventricular noncompaction (arrow) and heart dilatation. VSD ventricle septal defect, AAO ascending aorta, LV left ventricle, LA left atrium, RV right ventricle, RA right atrium, CM compact myocardium, NCM non-compact myocardium, IVS interventricular septum, STV septum tricuspid valve, ATV anterior tricuspid valve, AMV anterior mitral valve, PMV posterior mitral valve

Fig. 2

Black round symbols indicate individuals with asymptomatic LVNC; Yellow triangle symbols, individual with the presence of EA

Fig. 3

Transthoracic echocardiographic images. Apical 4-chamber views demonstrating LVNC with excessive trabeculations (arrow) in the grandmother (A) and older sister of the fetus (B)

Fig. 4

Sanger sequencing confirmed that the pregnant woman carried the MYH7 gene mutation (upper panel, red arrow), while her husband did not (lower panel). The mutation replaced the canonical splice donor sequence GT to GA (blue box), which is expected to disrupt RNA splicing and likely result in an absent or disrupted protein product. Primers used in this study were as below: chr14-23900793-F: ATGGCACTCACAGGTCTCTATG; chr14-23900793-R: GTACTTTGCTGTTATTGCAGCC. The length of the PCR product was 415 bp