Comparison of Isogenic Strains Shows No Evidence of Altered Nosocomial Transmission-Competency of Rough, GPL-Negative Mycobacterium abscessus Strains

Abstract

Mycobacterium abscessus is an emerging pathogen causing severe pulmonary infections. While environmental in origin, in the clinical setting M. abscessus often changes to a Rough phenotype associated with severe non-remitting infections. Clinical isolates baring mutations in glycopeptidolipid-synthesis genes, leading to the Rough phenotype, were suggested to have increase bacterial virulence while possibly showing reduced transmissibility on fomites. We set to determine whether an isolated glycopeptidolipid (GPL) defect affects transmissibility. We used transposon technology to create a fully isogenic Rough (GPL-defective) (Tn_4099c) and compare it to the isogenic parent strain (ATCC 19977). Survival on fomites was determined by spotting, drying, and retrieving the isolates at designated time points. This was repeated as a competition experiment using a mixture of differentially fluorescent M. abscessus 19977 (Smooth) and the Tn_4099c mutant (Rough). Survival ability in chlorhexidine solution (Septal Scrub Teva) was performed using a disinfectant killing-assay for mycobacteria. Despite significant bacterial killing in all assays, we found no survival advantage to either GPL-defected Rough or GPL-reserved Smooth morphotype-both on fomites and in chlorhexidine. Our findings suggest that while transmission fitness may be altered due to some within-host evolutionary changes, decreased transmissibility of clinical strains cannot be attributed to the GPL-synthesis defect alone. Further studies are needed to determine the effect of other mutations on the transmission potential of M. abscessus in the clinical setting. IMPORTANCE Mycobacterium abscessus is an emerging pathogen causing severe pulmonary infections. In the clinical setting, M. abscsssus undergoes molecular and genetic changes associated with increased virulence. Specifically, bacterial defects in glycopeptidolipid (GPL) synthesis, creating the "Rough" colony phenotype, have been associated with increased virulence, yet were also presumably observed to have decreased survival on fomites, leading to reduced transmissibility. We set to determine whether GPL-synthesis defects are indeed responsible for reduced transmissibility of clinical isolates. We compared fully isogenic GPL-disrupted versus GPL-preserved strains, and demonstrated no survival advantage for either strain on fomites. Additionally, neither isolate had a survival advantage in chlorhexidine, a widely used disinfectant in health care settings. Our findings suggest that reduced transmissibility of clinical isolates, should it be found, cannot be attributed to GPL-synthesis mutations. While clinical isolates may show changes in transmission potential, more studies are needed to investigate the mechanisms leading to these phenotypic changes.

Keywords: Mycobacterium abscessus; infection control; transmission; virulence.

FIG 1

Construction of a MAB_4099c inactivated transposon mutant. (A) Schematic representation of the genomic organization for the GPL complex. The insertion point for the 571 bp transposon is shown. (B) PCR using primers F (5′ – TGGAACTCAATGCCGGCACCATGGA – 3′) and R (5′ – TGTGCGGTCAGGACGAGCCGATGCTT – 3′) (shown in A) was performed on the wild type (WT) and the Tn_4099c mutant. The expected product of ∼650 bp (in WT) is longer in the Tn-mutant by the length of the transposon, confirming the insertion point. For further confirmation, the 1,200 bp product was sequenced by Sanger sequencing. (C) For unequivocal identification, ATCC19977 (S) was transfected with a red-fluorescence expressing plasmid (tdTomato), whereas the Tn_4099c mutant was transfected with an identical plasmid, expressing green fluorescence (mWasabi). Both fluorescent mutants are shown here, exemplifying how an unequivocal identification can be made.

FIG 2

Survival dynamics of Smooth and Rough isolates on fomites and in chlorhexidine. (A) Survival of M. abscessus ATCC 19977 and the Tn_4099c mutant after spotting on a sterile plastic 24-well plate was examined at designated time points. (B) A mixture of fluorescent M. abscessus 19977^tdTomato (Smooth,) and the Tn_4099c^mWasabi mutant (Rough,), was spotted in a 24-well plate, and viable CFU number was determined as described above. The proportion of Red:Green bacteria was assessed at designated time points. Two hundred to 400 colonies were examined at each time point. The results of three independent experiments, each with a slightly different initial Red:Green ratio, are shown. The Wilson score 95% confidence interval is shown in dashed lines. The combined P value of all three experiments does not reach significance (> 0.05), and the 99% CI is 0.94–1.44. (C) Killing of M. abscessus by a commercial chlorhexidine solution diluted to a concentration of 1% is shown. One (representative) calibration experiment out of two is shown. (D) A mixture of fluorescent M. abscessus 19977^tdTomato (Smooth) and the Tn_4099c^mWasabi mutant (Rough,) was placed in chlorhexidine 1%, and the ratio of S:R viable colonies was determined at designated time points, in three separate experiments. The Wilson score 95% confidence interval is shown in dashed lines; the combined P value for the three experiments is 0.12, with a 99% CI of 0.72–1.08.