Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex
- PMID: 35324198
- PMCID: PMC8991003
- DOI: 10.1021/jacs.2c00178
Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex
Abstract
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
Conflict of interest statement
The authors declare no competing financial interest.
Figures
References
Publication types
MeSH terms
Substances
Grants and funding
LinkOut - more resources
Full Text Sources
