Response to leucine in Schizosaccharomyces pombe (fission yeast)

Abstract

Leucine (Leu) is a branched-chain, essential amino acid in animals, including humans. Fungi, including the fission yeast Schizosaccharomyces pombe, can biosynthesize Leu, but deletion of any of the genes in this biosynthesis leads to Leu auxotrophy. In this yeast, although a mutation in the Leu biosynthetic pathway, leu1-32, is clearly inconvenient for this species, it has increased its usefulness as a model organism in laboratories worldwide. Leu auxotrophy produces intracellular responses and phenotypes different from those of the prototrophic strains, depending on the growing environment, which necessitates a certain degree of caution in the analysis and interpretation of the experimental results. Under amino acid starvation, the amino acid-auxotrophic yeast induces cellular responses, which are conserved in higher organisms without the ability of synthesizing amino acids. This mini-review focuses on the roles of Leu in S. pombe and discusses biosynthetic pathways, contribution to experimental convenience using a plasmid specific for Leu auxotrophic yeast, signaling pathways, and phenotypes caused by Leu starvation. An accurate understanding of the intracellular responses brought about by Leu auxotrophy can contribute to research in various fields using this model organism and to the understanding of intracellular responses in higher organisms that cannot synthesize Leu.

Keywords: Schizosaccharomyces pombe; leu1-32; TORC1; fission yeast; general amino acid control; leucine.

Figure 1.

Leucine biosynthesis pathway in fission yeast, Schizosaccharomyces pombe. The details of each process are described in the text. TPP, thiamine pyrophosphate; FAD, flavin adenine dinucleotide; PLP, pyridoxal phosphate.

Figure 2.

Schizosaccharomyces pombe SPAC17G8.06c (ilv3⁺) encodes a dihydroxy-acid dehydratase. (A) Growth of ED668 (h⁺ade6-M216 leu1-32 ura4-D18) and ΔSPAC17G8.06c (from Bioneer) strains in complete (YE), synthetic dextrose (SD), and Edinburgh minimal (EMM) media with supplements (Ade, 40 μg/mL adenine; Leu, 60 μg/mL leucine; Ura, 20 μg/mL uracil; Ile, 40 μg/mL isoleucine; Val, 40 μg/mL valine; 5 × Ile, 200 μg/mL isoleucine; 5 × Val, 200 μg/mL valine). (B) Growth of ΔSPAC17G8.06c cells carrying pREP41-Sp.ilv3⁺ (S. pombe SPAC17G8.06c inserted in pREP41) or pREP41-Sc.ILV3 (S. cerevisiae ILV3 inserted in pREP41) in EMM with supplements (Ade, 40 μg/mL adenine; Ura, 20 μg/mL uracil; 5 μg/mL thiamine). To make pREP41-Sp.ilv3⁺ and pREP41-Sc.ILV3, DNA fragments of the ilv3⁺ and ILV3 were amplified from each genome of S. pombe and S. cerevisiae using following primers, respectively: TTAGCATATGATGTTCTGCAAGCTTCTCC and CCAGGATCCTATGCGCGCTTATAAAAGCATTG for ilv3⁺, AGTACATATGGGCTTGTTAACGAAAGTTGC and ATAGGATCCTCGATTGGGGCCTATAATGC for ILV3. The amplified DNA fragments were digested with NdeI and BamHI and then cloned into the plasmid pREP41. The composition of SD medium is 0.67% yeast nitrogen base without amino acids (Difco) and 2% glucose. The composition of EMM is as previously described (Moreno et al. 1991).

Figure 3.

(A) Schizosaccharomyces pombe Leu1 (Sp_Leu1), S. cerevisiae Leu2 (Sc_Leu2), and E. coli LeuB (Ec_LeuB) amino acid sequences. The Gly 46 position corresponding to the S. pombe leu1-32 mutation and the corresponding Sc_Leu2 and Ec_LeuB positions are shown in red. In the leu1-32 mutation, this Gly is changed to Glu. (B) The three-dimensional structure of the 3-isopropylmalate dehydrogenase homodimer of E. coli (Ec_LeuB) shown from two different viewpoints (www.uniprot.org/uniprot/P30125). The mutation points of Gly corresponding to the S. pombe leu1-32 mutation are shown as red dots. This enzyme binds NADH to the active site with a divalent cation (Mn²⁺ takes precedence over Mg²⁺ or other divalent cations) (Wallon et al. , Gráczer et al. 2011). In the catalytic cycle, this enzyme performs domain closure, which is required for interactions between Mn²⁺ and the substrate (2R,3S)-3-isopropylmalate (Gráczer et al. 2011). Structural analysis using 3-isopropylmalate dehydrogenase of the bacterium Thermus thermophilus showed that Tyr139 and Lys185 are important for the catalytic function, which correspond to Tyr145 and Lys195 in E. coli LeuB and Tyr142 and Lys191 in S. pombe Leu1, respectively (Miyazaki and Oshima 1993, Palló et al. 2014). Structural analysis using T. thermophilus also showed that Mn²⁺ binds Asp 217 (second subunit of the dimeric enzyme), Asp241, and Asp 245, which correspond to Asp227, Asp251, and Asp255 in E. coli LeuB and Asp224, Asp249, and Asp253 in S. pombe Leu1, respectively (Palló et al. 2014). Furthermore, the substrate, (2R,3S)-3-isopropylmalate, binds T. thermophilus LeuB via the Lys94, Lys104, Lys132, Tyr139, Asp217 (second subunit of the dimeric enzyme via Mn²⁺), and Asp241 (via Mn²⁺), which correspond to Lys99, Lys109, Lys138, Tyr145, Asp227, and Asp251 in E. coli LeuB and Lys96, Lys106, Lys135, Tyr142, Asp224, and Asp249 in S. pombe Leu1, respectively (Palló et al. 2014).

Figure 4.

Response to leucine starvation in the fission yeast Schizosaccharomyces pombe. The details of each process are described in the text. AAT, amino acid transporter.