A genetically targeted sensor reveals spatial and temporal dynamics of acrosomal calcium and sperm acrosome exocytosis

Abstract

Secretion of the acrosome, a single vesicle located rostrally in the head of a mammalian sperm, through a process known as "acrosome exocytosis" (AE), is essential for fertilization. However, the mechanisms leading to and regulating this complex process are controversial. In particular, poor understanding of Ca2+ dynamics between sperm subcellular compartments and regulation of membrane fusion mechanisms have led to competing models of AE. Here, we developed a transgenic mouse expressing an Acrosome-targeted Sensor for Exocytosis (AcroSensE) to investigate the spatial and temporal Ca2+ dynamics in AE in live sperm. AcroSensE combines a genetically encoded Ca2+ indicator (GCaMP) fused with an mCherry indicator to spatiotemporally resolve acrosomal Ca2+ rise (ACR) and membrane fusion events, enabling real-time study of AE. We found that ACR is dependent on extracellular Ca2+ and that ACR precedes AE. In addition, we show that there are intermediate steps in ACR and that AE correlates better with the ACR rate rather than absolute Ca2+ amount. Finally, we demonstrate that ACR and membrane fusion progression kinetics and spatial patterns differ with different stimuli and that sites of initiation of ACR and sites of membrane fusion do not always correspond. These findings support a model involving functionally redundant pathways that enable a highly regulated, multistep AE in heterogeneous sperm populations, unlike the previously proposed "acrosome reaction" model.

Keywords: acrosome exocytosis; fertilization; microscopy; mouse; sperm.

Figure 1

Design and validation of the mouse line expressing Acr-GCaMP3er-mCherry (Acrosome-targeted Sensor for Exocytosis [AcroSensE]).A, schematic of the construct. B, validation of Acr-GCaMP3-mCherry expression in the model using RT-PCR in various tissues (brain (B), liver (L), heart (H), muscle (M), testis (T), and negative control). Primer sets were designed to amplify 149 base pairs between the proacrosin signal peptide and the GFP portion of the GCaMP3 (f’:catggtcctgctggagttcgtg, r’:ctggtcgagctggacgggcgacg). Actin was used as a positive control. C, immunoblot analysis of protein expression using anti-GFP confirmed high levels of expression of Acr-GCaMP3-mCherry in the testis at the predicted molecular weight of 75 kDa.

Figure 2

Representative traces of changes in fluorescence reflecting different Ca²⁺and membrane fusion dynamics under various conditions. Traces are provided as the fluorescence signal (F) after subtracting the fluorescence intensity at time point zero (F₀; F-F₀). A–D, representative traces of changes in acrosomal Ca²⁺ rise (ACR) resulting from increase in GCaMP3 fluorescence (green) and membrane fusion (MF), resulting from loss of mCherry fluorescence (red) following the addition of (A) ionophore A23187 (50 μM puff; estimated final concentration ∼10 μM) where we observed 2 distinct responses: rapid rise (left panel) and slow rise (right panel); (B) G_M1 (125 μM puff; final concentration ∼25 μM); (C) 2-hydroxypropyl β-cyclodextrin (CD; 20mΜ; final concentration ∼4 mM); (D) CD (4 mM) + EGTA (8 mM). Note that this specific trace (D) was chosen to demonstrate that the AcroSensE construct was functional, indicated by the loss of the mCherry signal, although no rise in GCaMP3 fluorescence was observed. The majority of cells under this condition did not undergo MF/AE. E–G, representative traces provided for (E) Low P4 (15 μM puff; final concentration ∼3 μM); (F) High P4 (300 μM puff; final concentration ∼60 μM), and (G) High P4 + bicarb + CD (final concentration of P4 ∼60 μM; 10 mM bicarb was only added during the incubation period). AcroSensE, Acrosome-targeted Sensor for Exocytosis.

Figure 3

Using AcroSensE to resolve acrosomal Ca²⁺rise (ACR) and membrane fusion (MF) during acrosome exocytosis.A, illustration of the changes over time in the CGaMP3 (green wavelength) and mCherry (red wavelength) fluorescence intensity signals. Increase of the GCaMP3 signal is a result of Ca²⁺ binding, while the loss of the mCherry signal is attributed to the loss of the AcroSensE protein out of the acrosome to the extracellular space. Note that the x-axis is expanded relative to Figure 2. B, summary of the percentage of cells demonstrating ACR (green bars) and MF (loss of mCherry signal, red bars) following A23187 (n = 93), G_M1 (n= 113), CD (n= 166), CD +EGTA (n= 164), Low P4 (n = 115), High P4 (n = 208), and High P4 + bicarb (n = 73). All concentrations identical to those in Figure 2. “+” or “-” indicate whether sperm were preincubated with 3 mM CD and/or 10 mM bicarbonate, respectively. Significant differences between conditions as measured by χ² (p < 0.01) are indicated by letters (for ACR) or numbers (for MF). In this and all subsequent figures, the appearance of the same letter or number shows no difference when comparing the values for those conditions. C, summary of the transition rates (% of cells) of sperm exhibiting transition from Ca²⁺ rise to MF, as calculated from (B). AcroSensE, Acrosome-targeted Sensor for Exocytosis; CD, 2-hydroxypropyl β-cyclodextrin.

Figure 4

Representative images of AcroSensE sperm undergoing different spatial patterns of acrosomal Ca²⁺rise (ACR), membrane fusion (MF), and acrosomal exocytosis (AE). A, visualization of bottom-to-top spatial progression of ACR and MF following addition of high P4 (+bicarb + CD) to AcroSensE sperm. The initial basal signal of the GCaMP3 is low, while maximal mCherry intensity is detected throughout the apical acrosome. Following stimulation, an increase in the GCaMP3 signal is detected near the bottom of the plasma membrane overlying the acrosome (arrow 1). The green signal then propagated rostrally (arrow 2), while a decrease in the red signal was observed near the same point of origin (arrow a) and then propagated in the same direction (arrow b). There was complete loss of both red and green signals in this cell, consistent with full MF and AE. B, visualization of top-to-bottom spatial progression of ACR and bottom-to-top progression of MF in the same sperm cell following addition of High P4 (+bicarb + CD). Before stimulation, the basal signal of the GCaMP3 is low, while maximal mCherry intensity is detected. Following stimulation, an increase in the GCaMP3 signal was detected near the top of the sperm head (arrow 1). The green signal propagated caudally toward the bottom of the sperm head (arrow 2), whereas a decrease in the red signal was observed at the bottom of the APM as soon as the green fluorescence intensity increased in that location (arrow a). The decrease in the red signal propagated rostrally toward the top of the sperm head (arrow b), resulting in a complete loss of both red and green signals. For both A and B, time is provided in seconds measured after the start of application of the stimulus, next to each frame. AcroSensE, Acrosome-targeted Sensor for Exocytosis; APM, acrosomal plasma membrane; CD, 2-hydroxypropyl β-cyclodextrin.

Figure 5

Spatial characteristics of ACR and membrane fusion (MF) events.A, the percentage of cells in each experimental condition demonstrating diffuse (D), top-to-bottom (T > B), center-to-top and center-to-bottom (C > TB), and bottom-to-top (B > T) progression of ACR as reflected in GCaMP3 signal. All conditions were statistically different (p < 0.001 for all conditions excepting Low-P4/Hi-P4 p = 0.008). See Fig. S2 for values of all comparisons associated with this figure. B, the percentage of cells in each experimental condition demonstrating diffuse (D), top-to-bottom (T > B), top-to-center and bottom-to-center (TB > C), and bottom-to-top (B > T) progression of the membrane fusion (MF) events as indicated by the loss of the mCherry signal. All conditions were statistically different (p < 0.001 for all conditions excepting G_M1/Hi-P4 p = 0.002), except for CD/Hi-P4 which were not significantly different (p = 0.39). C, summary of the percentage of cells that underwent AE following each of the spatially different Ca²⁺ rise progression patterns, under the various conditions. All conditions were statistically different with p < 0.001, except CD/Hi-P4 where p = 0.031. D, the percentage of cells in each experimental condition in which the MF and Ca²⁺ rise signals initiated at the same location. Note on nomenclature: in murine sperm, the apical acrosome is that portion that lies on the convex surface of the APM, so we use “rostral” or “top” to denote location near the perforatorium (tip) and “caudal” or “bottom” to denote location near the subacrosomal ring. ACR, acrosomal Ca²⁺ rise; AE, acrosome exocytosis; APM, acrosomal plasma membrane; CD, 2-hydroxypropyl β-cyclodextrin.

Figure 6

Characterization of Ca²⁺rise upon various stimulations. Statistical differences of p < 0.05 are noted by different letters. A, the average time from stimulation to the start of ACR. B, the average time of peak of the green GCaMP3 fluorescent signal. C, the average duration of the GCaMP3 signal rise, as calculated from the data presented in (A) and (B). D, the average total rise of the GCaMP3 fluorescent signal. E, the average rate of signal increase over time (slope) following stimulation. F, comparison of the slopes between cells that underwent membrane fusion and those that did not. ACR, acrosomal Ca²⁺ rise.

Figure 7

Summary of prespike foot (PSF)–like events preceding ACR. A, representative traces of PSF-like events following stimulations with A23817 (left) or high P4+bicarbonate+CD (right panel). The shaded area (green) is provided to highlight the PSF-like event. Arrows indicate the duration (D) and amplitude (A) above the baseline GCaMP3 signal, as measured for the analysis provided in (C) and (D). B, summary of PSF-like event occurrence (as the percentage of total cells) under various conditions. C, average duration of the PSF-like events, as measured from the initial rise of signal to the beginning of the main Ca²⁺ rise (see left panel in (A)). D, average amplitude of the fluorescence intensity increase during the PSF-like event. ACR, acrosomal Ca²⁺ rise.

Figure 8

Characterization of membrane fusion (MF) events under various conditions. Statistical differences of p < 0.05 are noted by different letters. A, a schematic illustration of typical MF proceeding until full AE as detected from the loss of mCherry fluorescence in the acrosome and the various parameters used in the analysis provided in (B–F). B, the average time in which MF initiated, as measured from the time of stimulation to the start of loss of the mCherry signal. C, the average duration of the mCherry fluorescence loss until it reached its minimum intensity. D, the average delay between the onset of the ACR (initial rise in green GCaMP3 signal) and the initiation of MF (mCherry signal loss). Compared to all other conditions, the delay between ACR and MF was the shortest for CD, with p values of 0.06 (A23187), 0.03 (G_M1), 0.01 (Low P4), 0.0003 (Hi P4), and 0.0005 (High P4 + bicarb). E, the average change in the mCherry signal during acrosome exocytosis (ΔF), normalized to the baseline fluorescence intensity (F0). F, the rate of signal loss over time as calculated from the slope of the mCherry fluorescence decay (as measured from the initiation of signal loss). ACR, acrosomal Ca²⁺ rise; AE, acrosome exocytosis; CD, CD, 2-hydroxypropyl β-cyclodextrin.

Figure 9

Schematic illustration of hypothesized changes in AcroSensE fluorescence, Ca²⁺flux, and membrane fusion (MF) events between the plasma membrane overlying the acrosome (APM) and outer acrosomal membrane (OAM) of the sperm head. Prespike foot (PSF)–like events occur as a result of transitory membrane fusions, either before or leading to more stable—but still small—fusion pores (FPs). These small focal fusion events enable Ca²⁺ influx into the acrosome. Full-membrane fusion leading to the loss of mCherry signal and the loss of acrosomal contents occurs as a result of coalescence of FPs. In this model, the dimensions of the FPs initially allow only for influx of small molecules into the acrosome’s lumen, including extracellular Ca²⁺ ions that can bind to the GCaMP3, resulting in an increase in the “green” fluorescence intensity (ACR). Progression of the FP into full-membrane fusion events results in much larger openings resulting from the loss of hybrid APM/OAM membrane vesicles, allowing the AcroSensE protein to diffuse out of the acrosome lumen into the extracellular space, resulting in a decrease in both the “red” and “green” fluorescence intensities. ACR, acrosomal Ca²⁺ rise; APM, acrosomal plasma membrane; OAM, outer acrosomal membrane.