Effects of intracardiac delivery of aldehyde dehydrogenase 2 gene in myocardial salvage

Abstract

Intrinsic activity of aldehyde dehydrogenase (ALDH)2, a cardiac mitochondrial enzyme, is vital in detoxifying 4-hydroxy-2-nonenal (4HNE) like cellular reactive carbonyl species (RCS) and thereby conferring cardiac protection against pathological stress. It was also known that a single point mutation (E487K) in ALDH2 (prevalent in East Asians) known as ALDH2*2 reduces its activity intrinsically and was associated with increased cardiovascular diseases. We and others have shown that ALDH2 activity is reduced in several pathologies in WT animals as well. Thus, exogenous augmentation of ALDH2 activity is a good strategy to protect the myocardium from pathologies. In this study, we will test the efficacy of intracardiac injections of the ALDH2 gene in mice. We injected both wild type (WT) and ALDH2*2 knock-in mutant mice with ALDH2 constructs, AAv9-cTNT-hALDH2-HA tag-P2A-eGFP or their control constructs, AAv9-cTNT-eGFP. We found that intracardiac ALDH2 gene transfer increased myocardial levels of ALDH2 compared to GFP alone after 1 and 3 weeks. When we subjected the hearts of these mice to 30 min global ischemia and 90 min reperfusion (I-R) using the Langendorff perfusion system, we found reduced infarct size in the hearts of mice with ALDH2 gene vs GFP alone. A single time injection has shown increased myocardial ALDH2 activity for at least 3 weeks and reduced myocardial 4HNE adducts and infarct size along with increased contractile function of the hearts while subjected to I-R. Thus, ALDH2 overexpression protected the myocardium from I-R injury by reducing 4HNE protein adducts implicating increased 4HNE detoxification by ALDH2. In conclusion, intracardiac ALDH2 gene transfer is an effective strategy to protect the myocardium from pathological insults.

Figure 1.. Map of ALDH2 construct.

AAV9 pCWB-cTNT-hALDH2-HA tag-P2A-eGFP Human ALDH2 was subcloned into the SalI/NotI sites of pCWB cTNT-eGFP. ALDH2-HA-P2a was PCR amplified from an ALDH2 containing clone obtained from Dharmacon (clone MHS6278-202828919 clone ID: 3543343). PCR primers used to amplify the H.s. ALDH2-HA-P2a are as follows: ALDH2 SalI F Primer: 5’- TCCGTGGATATCTAGACGCGTCGACCACC ATGTTGCGCGCTGCCGCCCGCT-3’. ALDH2 HA-P2a NcoI R Pirmer: 5’-AGCTCCTCGCC CTTGCTCACCATGGTAGGACCGGGGTTTTCTTCCACGTCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCTCCGGATCCAGCGTAATCTGGAACATCGTATGGGTATGCTGAGTTCTTCTGAGGCA-3’. Map shows single cutting restriction enzyme sites.

Figure 2.. Immunofluorescence imaging of Hoechst dye from injection, GFP from the construct and ALDH2 from staining show effective transduction.

Representative micrographs of cardiac sections showing intracardiac injection sites in the myocardial tissue with Hoechst dye (A, B & E) as well as GFP (C & F) and ALDH2 (D & G) immunofluorescence staining from both AAV9-GFP and AAV9-ALDH2-GFP. N=3 per group The white arrows show the injection site in the myocardium where cells took up Hoechst dye as the constructs were injected with Hoechst dye.

Figure 3.. Cardiac ALDH2 levels after one and three weeks of intracardiac transfection.

Representative Western blot images of ALDH2 and β-actin one week (A) and three weeks (B) after transfection. The quantification data of cardiac ALDH2 levels for one week, (C) and 3 weeks, (D) were shown. Data are presented as mean ± standard error of the mean (SEM). N=6 per group; by ***P<0.001 VS AAV-GFP.

Figure 4.. Cardiac ALDH2 levels, ALDH2 activity and 4HNE protein adducts in the WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections.

Representative Western blot images of ALDH2, 4HNE protein adducts and β-actin were shown from the homogenized hearts that were subjected to I-R injury (A). The quantitative data of ALDH2 activity (B, F=46.6 and p<0.001 in One-Way ANOVA), ALDH2 levels (C, F=138.1 and p<0.001 in One-Way ANOVA) and multiple 4HNE adduct bands (D, F>2 and p<0.05 of each band in ANOVA) were shown. Data are presented as mean ± standard error of the mean (SEM). N=6 per group; *P<0.05, **P<0.01 and ***P<0.001 refer to the difference between individual groups as shown.

Figure 5.. Myocardial infarct size measurements of WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections.

Representative macroscopic images of TTC stained myocardial slices from WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections. The red color indicates viable myocardium while the * symbol labelled pale color area indicates infarcted tissue (A). The quantitative data of % myocardial infarction was shown, (B, F=54.2 and p<0.001 in One-Way ANOVA). Data are presented as mean ± standard error of the mean (SEM). N=6 per group; **P<0.01 and ***P<0.001 refer to the difference between individual groups as shown.

Figure 6.. Changes in cardiac functional indices of WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections.

Basal cardiac functional parameters {HR (A, F=0.17 and p>0.05 in ANOVA), LVP, (B, F=0.11 and p>0.05 in ANOVA), +dP/dt (C, F=1.0 and p>0.05 in ANOVA), −dP/dt (D, F=1.8 and p>0.05 in ANOVA) and PP (E, F=0.19 and p>0.05 in ANOVA)} and post I-R mediated cardiac functional changes {HR (F, F=10.2 and p<0.01 in ANOVA), LVP (G, F=11.8 and p<0.001 in ANOVA), +dP/dt (H, F=31.5 and p<0.001 in ANOVA), −dP/dt (I, F=31.5 and p<0.001 in ANOVA) and PP (J, F=0.24 and p>0.05 in ANOVA)} were shown. N=6 per group; *P<0.05, **P<0.01 and ***P<0.001 refer to the difference between individual groups as shown.