Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2022 May;10(10):603.
doi: 10.21037/atm-22-2179.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing

Jiang-Tao Mou #  1 , Shi-Xing Huang #  2 , Li-Li Yu  3 , Jing Xu  3 , Qiao-Ling Deng  4 , Yi-Shan Xie  1 , Kun Deng  1
Affiliations

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing

Jiang-Tao Mou et al. Ann Transl Med. 2022 May.

Abstract

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.

Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.

Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).

Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Keywords: Whole exome sequencing; genetic polymorphisms; signaling pathway; unexplained recurrent spontaneous abortion (URSA).

PubMed Disclaimer

Conflict of interest statement

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-2179/coif). All authors report that this study was funded by the Science and Technology Research Project of Chongqing Education Commission (No. KJQN202100427) and the Young and Middle-Aged Medical Talents Project of Chongqing Municipal Health Commission/Chongqing Science and Technology Bureau (No. 2022GDRC001). The authors have no other conflicts of interest to declare.

Figures

Figure 1
Figure 1
The general mutational landscape of 30 couples with unexplained recurrent spontaneous abortion. (A) The distribution of the top 34 mutated genes in 30 couples with URSA. Different colors represented different mutation types. Y-axis represents total number of variations in all genes involved in a sample. (B) The different variant types. The x-axis and y-axis represent the number of variants and the variant type, respectively. (C) The SNV class. The x-axis and y axis represent the ratio and the SNV class, respectively. The number on the right represents the number of SNV class. (D) The variant classification. The x-axis and y-axis represent variant classification and number of variant classifications, respectively. (E) The top 34 mutated genes. The x-axis and y-axis represent the number of variants and the mutated genes, respectively. The number on the right represents the percentage of mutated genes. URSA, unexplained recurrent spontaneous abortion; SNV, single nucleotide variant.
Figure 2
Figure 2
Prediction of protein function and conservative analysis of missense variants. (A) The predicted protein function of the 12 missense variants. (B) A conservative analysis of the 12 missense variants.
Figure 3
Figure 3
The 19 strongly associated mutant genes detected in 23 couples with unexplained recurrent spontaneous abortion. (A) The distribution of the top 19 mutated genes in 23 couples with URSA. Different colors represent different mutation types. Y-axis represents total number of variations in all genes involved in a sample. (B) The variant types. The x axis and y axis represent the number of variants and the variant type, respectively. (C) The SNV classes. The x-axis and y-axis represent the ratio and the SNV class, respectively. The number on the right represents the number of SNV classes. (D) The variant classification. The x-axis and y-axis represent the variant classification and the number of variant classifications, respectively. (E) The 19 mutated genes that are strongly associated with URSA. The x-axis and y-axis represent the number of variants and the mutated genes, respectively. The number on the right represents the percentage of mutated genes. URSA, unexplained recurrent spontaneous abortion; SNV, single nucleotide variant.
Figure 4
Figure 4
Gene Ontology analysis. (A) Gene Ontology analysis of the mutated genes in both couples. (B) The top 100 Gene Ontology analysis results of mutated genes in the mother. (C) The top 100 Gene Ontology analysis results of mutated genes in the father.
Figure 5
Figure 5
Sanger validations of the ANXA5, APP, COL4A2, DNMT1, FN1, ITGB1, LAMA4, MSH2, POLR2B, THBS1, KDR, PLK1, and CCNB3 variants.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. ESHRE Guideline Group on RPL ; Bender Atik R, Christiansen OB, et al. ESHRE guideline: recurrent pregnancy loss. Hum Reprod Open 2018;2018:hoy004. 10.1093/hropen/hoy004 - DOI - PMC - PubMed
    1. Practice Committee of the American Society for Reproductive Medicine . Evaluation and treatment of recurrent pregnancy loss: a committee opinion. Fertil Steril 2012;98:1103-11. 10.1016/j.fertnstert.2012.06.048 - DOI - PubMed
    1. Suzumori N, Sugiura-Ogasawara M. Genetic factors as a cause of miscarriage. Curr Med Chem 2010;17:3431-7. 10.2174/092986710793176302 - DOI - PubMed
    1. Saravelos SH, Regan L. Unexplained recurrent pregnancy loss. Obstet Gynecol Clin North Am 2014;41:157-66. 10.1016/j.ogc.2013.10.008 - DOI - PubMed
    1. Christiansen OB, Nielsen HS, Pedersen B. Active or passive immunization in unexplained recurrent miscarriage. J Reprod Immunol 2004;62:41-52. 10.1016/j.jri.2003.09.003 - DOI - PubMed