Molecular basis of anti-CRISPR operon repression by Aca10

Abstract

CRISPR-Cas systems are bacterial defense systems for fighting against invaders such as bacteriophages and mobile genetic elements. To escape destruction by these bacterial immune systems, phages have co-evolved multiple anti-CRISPR (Acr) proteins, which inhibit CRISPR-Cas function. Many acr genes form an operon with genes encoding transcriptional regulators, called anti-CRISPR-associated (Aca) proteins. Aca10 is the most recently discovered Aca family that is encoded within an operon containing acrIC7 and acrIC6 in Pseudomonas citronellolis. Here, we report the high-resolution crystal structure of an Aca10 protein to unveil the molecular basis of transcriptional repressor role of Aca10 in the acrIC7-acrIC6-aca10 operon. We identified that Aca10 forms a dimer in solution, which is critical for binding specific DNA. We also showed that Aca10 directly recognizes a 21 bp palindromic sequence in the promoter of the acr operon. Finally, we revealed that R44 of Aca10 is a critical residue involved in the DNA binding, which likely results in a high degree of DNA bending.

Figure 1.

Crystal structure of Aca10 derived from Pseudomonas citronellolis. (A) Size-exclusion chromatography profile of Aca10. SDS-PAGE gel showing the protein fractions eluted at the peak position. (B) Cartoon representation of the structure of four Aca10 molecules presented in a crystallographic asymmetric unit. (C) Cartoon representation of the monomeric Aca10 structure. The color of the chain from the N- to the C-termini gradually moves through the spectrum from blue to red. (D) Topological representation of secondary structure of Aca10. (E) Surface electrostatic potential of Aca10. The scale bar ranges from − 6.9 kT/e (red) to 6.9 kT/e (blue). (F) B-factor distribution in the structure of Aca10. The structure is presented in a putty representation and rainbow colors from red to violet demonstrate the order of the B-factor values. (G) Superimposition of four molecules detected in one asymmetric unit; the colors correspond to the monomers within the asymmetric unit as shown in (B). (H and I) Structural comparison of crystal structure (green) with predicted structure (orange) generated by AlphaFold2 in cartoon (H) and stick figure (I). Those residues that were not perfectly aligned were labelled.

Figure 2.

Dimeric structure of Aca10 and analysis of its interface and conformation. (A) Multi-angle light scattering (MALS) profile of Aca10 corresponding to the main peak of the SEC. The red line indicates the experimental molecular weight analyzed by MALS. (B) Crystallographic packing symmetry analysis. Two possible types of Aca10 dimer (AB and BC dimers) found in the crystallographic asymmetric unit are shown. PPI regions are indicated by black dotted boxes. (C) Table summarizing the PPI details of the two types of dimers analyzed by the PISA server. (D and E) Magnified view of the PPI highlighted in panel (B) for the AB dimer (D) and the BC dimer (E). Salt bridges and hydrogen bonds are indicated by red dotted lines and black dotted lines, respectively. (F) Verification of the PPI via mutagenesis. SEC-MALS profiles comparing the position of eluted peaks between wildtype and mutant proteins. The red line indicates the experimental molecular mass analyzed by MALS. (G) Table summarizing the result of MALS and mono- or dimeric status of each mutant. MW indicates molecular weight and fitting error indicate the MALS fitting error.

Figure 3.

Promoter identification and specific interaction by Aca10. (A) The location of the tentative H-T-H motif on the structure of Aca10. (B) The acrIC7-acrIC6-aca10 operon in its genomic context, with the predicted regulatory region, including -35 and -10 promoter elements, highlighted underneath. Two pairs of inverted repeats (IRs) are indicated by blue arrows. (C) Sequences of the IR12, IR1 and IR2 DNA probes used in subsequent experiments. (D-F) EMSAs of the IR12 DNA probe (D), IR1 DNA probe (E), and IR2 DNA probe (F) with increasing concentrations of Aca10 indicated by black triangles. Bovine serum albumin (BSA), which is not expected to bind DNA, was used as a negative control. (G) Mutated sites on the IR12 DNA fragment. Mutated sequence for IR1 disruption and IR2 disruption are indicated by red stars and blue stars, respectively. (H) EMSAs of the mutated IR12 DNA probes with no or 2.5 μM Aca10. (I) EMSAs of other inverted DNA probes with no or 2.5 μM Aca10. Aca1 IR: ACAAGCGGCACACTGTGCCTATTGCGAATTAGGCACAATGTGCCTAATCTAACG and Aca2 IR: CACTGTTCGCAATTGCGAACTAAGATGGAACCAGATTCGAGATTGGCTCGAATCACCTC. (J) A series of truncated IR2 oligoes tested for binding to Aca10. (K) EMSA of a series of truncated IR2 oligos with no or 2.5 μM Aca10

Figure 4.

Promoter DNA interaction analysis with dimer disruption mutants. (A and B) EMSAs of the IR12 DNA probe (A) and IR2 DNA probe (B) with increasing concentrations of dimer disruption mutants of Aca10 indicated by black triangle. DNA probes used in the experiment are indicated below the gel. The concentrations of each mutant as well as wildtype Aca10 are indicated with each lane in the gel.

Figure 5.

Strategy of promoter recognition by dimeric Aca10. (A) Cartoon representation of dimeric Aca10 colored according to the degree of amino-acid sequence conservation (ConSurf). (B) Sequence alignment of Aca10 homologs from different species. Mostly conserved and partially conserved residues are colored in red and blue, respectively. The location of the putative H-T-H motif is shown above the sequence. # indicates conserved residues that might be involved in the DNA recognition. * indicates the conserved residues involved in the formation of the dimeric interface. (C) Superimposition of the dimeric Aca10 structure with an Aca2/DNA complex structure (PDB id: 7VJQ). Representative residues that might be involved in the DNA recognition were indicated and labeled cyan (Aca10) and gray (corresponding residues on Aca2). (D) EMSAs of the IR12 DNA probe with increasing concentration (indicated by black triangles) of putative DNA binding-disturbed mutants, including Q22Y, Q37W, and R44Y. (E) Surface electrostatic features of dimeric Aca10. The scale bar ranges from −6.8 kT/e (red) to 6.8 kT/e (blue). (F) Structural model of an Aca10/bent DNA complex generated using the HDOCK server. Residues Q22, Q37 and R44, which were experimentally shown to be involved in the readout of the palindromic sequence are labeled in the structure. The distance between two α₃ helices in the H-T-H motif from both molecules is indicated by a black double headed arrow.