Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2022 Aug 29;11(9):985.
doi: 10.3390/pathogens11090985.

Strain Variation Based on Spike Glycoprotein Gene of SARS-CoV-2 in Kuwait from 2020 to 2021

Nada Madi  1 , Mohammad Sadeq  2 , Sahar Essa  1 , Hussain A Safar  3 , Anfal Al-Adwani  1 , Marwa Al-Khabbaz  1
Affiliations

Strain Variation Based on Spike Glycoprotein Gene of SARS-CoV-2 in Kuwait from 2020 to 2021

Nada Madi et al. Pathogens. .

Abstract

Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) is the causative agent of coronavirus disease 2019 (COVID-19), which was first identified in Wuhan, China, in December 2019. With the global transmission of the virus, many SARS-CoV-2 variants have emerged due to the alterations of the spike glycoprotein. Therefore, the S glycoprotein encoding gene has widely been used for the molecular analysis of SARS-Co-2 due to its features affecting antigenicity and immunogenicity. We analyzed the S gene sequences of 35 SARS-CoV-2 isolates in Kuwait from March 2020 to February 2021 using the Sanger method and MinION nanopore technology to confirm novel nucleotide alterations. Our results show that the Kuwaiti strains from clade 19A and B were the dominant variants early in the pandemic, while clade 20I (Alpha, V1) was the dominant variant from February 2021 onward. Besides the known mutations, 21 nucleotide deletions in the S glycoprotein in one Kuwaiti strain were detected, which might reveal a recombinant SARS-CoV-2 with the defective viral genome (DVG). This study emphasizes the importance of closely perceiving the emerging clades with these mutations during this continuous pandemic as some may influence the specificity of diagnostic tests, such as RT-PCR and even vaccine design directing these positions.

Keywords: Kuwait; SARS-CoV-2; spike glycoprotein; strain variation.

PubMed Disclaimer

Conflict of interest statement

The authors declare no conflict of interest.

Figures

Figure 1
Figure 1
Phylogenetic tree of Kuwaiti sequences based on s gene sequencing compared to the global strains. (A) Maximum clade credibility tree constructed by Nextclade (https://clades.nextstrain.org/ accessed on 21 August 2022) of S gene sequences from Kuwait and all sequences available in GISAID. Global clades are colored differently, and clades corresponding to Kuwaiti strains are circled in red. (B) Divergence of Kuwait strains clade 20I (Alpha, V1) from 19A clade. (C) Divergence of Kuwait strains clade 19B from 19A clade.
Figure 1
Figure 1
Phylogenetic tree of Kuwaiti sequences based on s gene sequencing compared to the global strains. (A) Maximum clade credibility tree constructed by Nextclade (https://clades.nextstrain.org/ accessed on 21 August 2022) of S gene sequences from Kuwait and all sequences available in GISAID. Global clades are colored differently, and clades corresponding to Kuwaiti strains are circled in red. (B) Divergence of Kuwait strains clade 20I (Alpha, V1) from 19A clade. (C) Divergence of Kuwait strains clade 19B from 19A clade.
Figure 2
Figure 2
Sequence phylogeny of SARS-CoV-2 spike gene strains in Kuwait. Phylogenic tree representing SARS-CoV-2 circulated in Kuwait and other SARS-CoV-2 variants, retrieved from the NCBI database using the Neighbor-Joining method of MEGA 7 based on the Kimura 2-parameter method substitution model, and tree structure was confirmed by running analysis on 1000 bootstraps. The branch length is indicated in the scale bar. Reference strains are indicated by ●.
Figure 3
Figure 3
Deletions identified in the SARS-CoV-2 strain (KW-35A). High-throughput sequencing of the KW-35A strain revealed 21 nt deletions (22331-22351/GGTTGGACAGCTGGTGCTGCA) in the S gene corresponding to aa deletions (G257-A263) in spike glycoprotein. NC-045512.2 was used as a reference strain. Diagram was generated by the Genome Detective Coronavirus Typing Tool Version 1.13 (https://www.genomedetective.com/app/typingtool/cov/ accessed on 21 August 2022).
See this image and copyright information in PMC

Similar articles

See all similar articles

References

    1. Ralph R., Lew J., Zeng T., Francis M., Xue B., Roux M., Ostadgavahi A.T., Rubino S., Dawe N.J., Al-Ahdal M.N., et al. 2019-NCoV (Wuhan Virus), a Novel Coronavirus: Human-to-Human Transmission, Travel-Related Cases, and Vaccine Readiness. J. Infect. Dev. Ctries. 2020;14:3–17. doi: 10.3855/jidc.12425. - DOI - PubMed
    1. COVID-19 Map—Johns Hopkins Coronavirus Resource Center. [(accessed on 26 April 2021)]. Available online: https://coronavirus.jhu.edu/map.html.
    1. Gorbalenya A.E., Baker S.C., Baric R.S., de Groot R.J., Drosten C., Gulyaeva A.A., Haagmans B.L., Lauber C., Leontovich A.M., Neuman B.W., et al. The Species Severe Acute Respiratory Syndrome-Related Coronavirus: Classifying 2019-NCoV and Naming It SARS-CoV-2. Nat. Microbiol. 2020;5:536–544. - PMC - PubMed
    1. Mohammad Lokman S., Rasheduzzaman M., Salauddin A., Barua R., Yeasmin Tanzina A., Hasan Rumi M., Imran Hossain M., Zonaed Siddiki A., Mannan A., Mahbub Hasan M. Exploring the Genomic and Proteomic Variations of SARS-CoV-2 Spike Glycoprotein: A Computational Biology Approach. Infect. Genet. Evol. 2020;84:104389. doi: 10.1016/j.meegid.2020.104389. - DOI - PMC - PubMed
    1. Zhou P., Yang X.-L., Wang X.-G., Hu B., Zhang L., Zhang W., Si H.-R., Zhu Y., Li B., Huang C.-L., et al. A Pneumonia Outbreak Associated with a New Coronavirus of Probable Bat Origin. Nature. 2020;579:270–273. doi: 10.1038/s41586-020-2012-7. - DOI - PMC - PubMed

LinkOut - more resources