Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2023 Jul;65(7):1076-1084.
doi: 10.1007/s12033-022-00596-9. Epub 2022 Nov 27.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules

Guang-Ping Ruan  1   2   3 , Shu-Qian Lin  4   5   6 , Kai Wang  4   5   6 , Zi-An Li  4   5   6 , Xing-Hua Pan  7   8   9
Affiliations

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules

Guang-Ping Ruan et al. Mol Biotechnol. 2023 Jul.

Abstract

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Keywords: Human umbilical cord mesenchymal stem cells; Increased pluripotency; Pluripotency factor; Transfection; tRF molecule.

PubMed Disclaimer

Similar articles

See all similar articles

References

    1. Goodarzi, H., Liu, X., Nguyen, H. C., Zhang, S., Fish, L., & Tavazoie, S. F. (2015). Endogenous tRNA-derived fragments suppress breast cancer progression via YBX1 displacement. Cell, 161, 790–802. - DOI - PubMed - PMC
    1. Anderson, P., & Ivanov, P. (2014). tRNA fragments in human health and disease. FEBS Letters, 588, 4297–4304. - DOI - PubMed - PMC
    1. Balatti, V., Nigita, G., Veneziano, D., Drusco, A., Stein, G. S., Messier, T. L., Farina, N. H., Lian, J. B., Tomasello, L., Liu, C. G., Palamarchuk, A., Hart, J. R., Bell, C., Carosi, M., Pescarmona, E., Perracchio, L., Diodoro, M., Russo, A., Antenucci, A., … Croce, C. M. (2017). tsRNA signatures in cancer. Proceedings of the National Academy of Sciences of USA, 114, 8071–8076. - DOI
    1. Green, D., Fraser, W. D., & Dalmay, T. (2016). Transfer RNA-derived small RNAs in the cancer transcriptome. Pflugers Archiv, 468, 1041–1047. - DOI - PubMed - PMC
    1. Castner, J., Amiri, A., & Huntington-Moskos, L. (2020). Applying the NIEHS translational research framework (NIEHS-TRF) to map clinical environmental health research trajectories. Nursing Outlook, 68, 301–312. - DOI - PubMed - PMC

Substances

LinkOut - more resources