Application of a universal parasite diagnostic test to biological specimens collected from animals

Abstract

A previously described universal parasite diagnostic (nUPDx) based on PCR amplification of the 18S rDNA and deep-amplicon sequencing, can detect human blood parasites with a sensitivity comparable to real-time PCR. To date, the efficacy of this assay has only been assessed on human blood. This study assessed the utility of nUPDx for the detection of parasitic infections in animals using blood, tissues, and other biological sample types from mammals, birds, and reptiles, known to be infected with helminth, apicomplexan, or pentastomid parasites (confirmed by microscopy or PCR), as well as negative samples. nUPDx confirmed apicomplexan and/or nematode infections in 24 of 32 parasite-positive mammals, while also identifying several undetected coinfections. nUPDx detected infections in 6 of 13 positive bird and 1 of 2 positive reptile samples. When applied to 10 whole parasite specimens (worms and arthropods), nUPDx identified all to the genus or family level, and detected one incorrect identification made by morphology. Babesia sp. infections were detected in 5 of the 13 samples that were negative by other diagnostic approaches. While nUPDx did not detect PCR/microscopy-confirmed trichomonads or amoebae in cloacal swabs/tissue from 8 birds and 2 reptiles due to primer template mismatches, 4 previously undetected apicomplexans were detected in these samples. Future efforts to improve the utility of the assay should focus on validation against a larger panel of tissue types and animal species. Overall, nUPDx shows promise for use in both veterinary diagnostics and wildlife surveillance, especially because species-specific PCRs can miss unknown or unexpected pathogens.

Keywords: Diagnosis; High throughput sequencing; Illumina; Parasite; Veterinary; Wildlife.

Graphical abstract

Fig. 1

Schematic describing the nested UPDx protocol employed in this study. This schematic provides a summary of the nested UPDx (nUPDx) protocol originally described by Flaherty et al. (Flaherty et al., 2021). Briefly, the DNA extract is subjected to a restriction digestion using the PstI restriction enzyme, and the digest product is subjected to PCR1 using primers 5’TTGATCCTGCCAGTAGTCATATGC’3 (outer forward) and 5’GGTGTGTACAAAGGGCAGGGAC’3 (outer reverse). The resultant ∼2 kb amplicon is digested using the restriction enzymes BamHI and BsoBI. The digest product is then subjected to PCR2 using internal primers 5’CCGGAGAGGGAGCCTGAGA’3 (inner forward) and 5’GAGCTGGAATTACCGCGG’3 (inner reverse) originally described by Flaherty et al. (Flaherty et al., 2018, 2021). The amplicon of PCR2 (∼200 base pairs) is finally subjected to Illumina amplicon sequencing.

Fig. 2

Cluster dendrogram showing parasite species detected in mammalian hosts. Sequences detected in each specimen using nUPDx were clustered alongside parasite-derived reference sequences of known identity obtained from GenBank. These reference sequences are labelled on the dendrogram branch tips (where appropriate). A peripheral color-coded heat map ring indicates the host animal from which the parasite-derived sequence was detected. Gray branches and blocks on the heat map reflect the position of reference sequences within the tree. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 3

Cluster dendrogram showing parasite species detected in avian and reptilian hosts. Sequences detected in each specimen using nUPDx were clustered in this dendrogram alongside parasite-derived reference sequences of known identity obtained from GenBank. These reference sequences are labelled on the dendrogram branch tips (where appropriate). A peripheral color-coded heat map ring indicates the host animal from which the parasite-derived sequence was detected. Gray branches and blocks on the heat map reflect the position of reference sequences within the tree. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)