A Decrease in CD44 on Cell Surfaces (MKN-45 cell line) After RELA Knockout Using CRISPR/Cas9

Abstract

The NF-kB signaling pathway was introduced as a key pathway in carcinogenesis that is induced by inflammation in gastrointestinal malignancies. The RelA transcription factor is an important component of this signaling pathway. Furthermore, CD44 is implicated in the tumorigenesis and metastasis of gastric cancer. The aim of this study was to assay the effect of RELA knockout on CD44 expression in MKN45 cells. CRISPR/Cas9 was used to knock out RELA in MKN-45. The median fluorescence intensity (MFI) of CD44 before and after RELA knockout is analyzed in MKN45. The CRISPR/Cas9 vector pSpCas9 (BB)-2A-Puro (PX459) was used for gRNA cloning (two guides). The MKN-45 cell line was co-transfected. The purified co-transfected cells with puromycin were cultured and used for the RELA gene expression assay by real-time PCR. Flow cytometry was used for the analysis of the MFI of CD44+ in MKN45. The results showed that 180 nucleotide sequences between exon 2 and exon 3 of RELA were deleted in MKN45. RELA expression significantly (P<0.001) decreased after CRISPR/Cas9 knockout. Compared to the control group, the MFI of CD44 in transfected cells significantly decreased (P <0.001). Knockout of RELA significantly decreased CD44 expression in MKN45 cells. It can be concluded that the NF-kB signaling pathway via RELA is related to CD44 expression and consequently the tumorigenesis of gastric cancer. More studies about this relationship are recommended.

Keywords: CD44; CRISPR/Cas9; MKN-45 cell line; RELA; knockout.

Fig.1

Preparation and validation of the knocked-out MKN45 cell line. A) The sequences and positions of the guides on the RELA gene (red sequences). gRNA1: GGCGAGAGGAGCACAGATAC, and gRNA2: AGGGAC AGTGCGCATCTCCC. Yellow region: The sequences that are removed from the genome by knockout. Purple Zone: Parts of Exons 2 and 3. B) A schematic picture of plasmid PX459 cloned with gRNAs separately. C) Prove the cloning of guides in two vectors separately. A forward primer on the U6 and complementary sequence of guides as reversal primers; Primer sgRNA1 reverse: GGCGAGAGGAGCACAGATAC, and Primer sgRNA2 reverse: AGGGACAG TGCGCATCTCCC, and U6-F: GAGGGCCTATTTCCCATGATT Product length is 267 bp

Fig.2

Positive cell confirmation results. A) PCR results in six clones originating from a single amplified cell show that both gRNAs acted in only one cell clone, deleting about 180 bp in the RELA gene. Knock out colony cells with a 180 bp deletion of the RELA gene sequence on the agarose gel. (Marker M: 100 bp ladder). B) Positive cells sequencing result confirms 180 bp deletion. The arrow indicates the location of the deletion

Fig.3.

RELA gene expression. After transfection, expression RELA was examined in triplicate, and the results are presented as mean ± SD. Expression levels RELA were normalized by GAPDH as an internal control. A decrease in RELA expression was observed in the transfected cells group (MKN-45 Knock out) compared to the control group (*** = P<0.001)

Fig.4

MFI averages in the control (MKN-45) and treatment (MKN-45 knockout) groups. MFI was decreased significantly in the transfected cells (*** = P<0.001)