Highlighting vulnerabilities in the alternative lengthening of telomeres pathway

Abstract

The alternative lengthening of telomeres (ALT) pathway is a telomere elongation mechanism found in a small but often aggressive subset of cancers. Dependent on break-induced replication, telomere extension in ALT-positive cells relies on a baseline level of DNA replication stress to initiate elongation events. This results in an elevated level of DNA damage and presents a possible vulnerability to be exploited in the development of ALT-targeted cancer therapies. Currently, there are no treatment options that target the ALT mechanism or that are specific for ALT-positive tumors. Here, we review recent developments and promising directions in the development of ALT-targeted therapeutics, many of which involve tipping the balance towards inhibition or exacerbation of ALT activity to selectively target these cells.

Figure 1:. ALT cells are more sensitive to combined depletion of ATRX and SMARCAL1.

A) Viability of cell line panel with combined RNAi for ATRX and SMARCAL1. Knockdown was achieved using either siRNA or shRNA, as indicated in the table. Cells were treated with 20 nM siRNA for SMARCAL1 (Dharmacon 5’- UUUCACAGAGAAAUGCUUAUGCAGGU −3’) and/or 20 nM siRNA for ATRX (Invitrogen NM_000489.3 Stealth RNAi) on day 0, and again on day 4 after plating, using Lipofectamine RNAiMax. Other cell lines were infected with shATRX (Sigma MISSION TRCN0000342811) or treated with 2 ug/mL doxycycline to induce expression of shSMARCAL1 (Dharmacon SMARTvector inducible human SMARCAL1 hEF1α-TurboGFP shRNA). Viability was determined on day 7 using CellTiter-Glo assay (Promega). Each dot represents average of three biological replicates. p = 0.0308, unpaired t test. B) Relative viability of SMARCAL1-deficient cell lines NY and CAL78 following knockdown of ATRX and DAXX by CellTiter-Glo luminescence assay. Cells were treated with 20 nM siRNA for ATRX and/or DAXX (Dharmacon J-004420-08-0100) on day 0 and day 4 after plating. Viability was determined on day 7 using CelllTiter-Glo assay. Bars represent mean with standard deviation. n = 6 for NY, n = 3 for CAL78. ** p < 0.01, **** p < 0.0001, ordinary one-way ANOVA with Tukey’s multiple comparisons tests.

Figure 1:. ALT cells are more sensitive to combined depletion of ATRX and SMARCAL1.

A) Viability of cell line panel with combined RNAi for ATRX and SMARCAL1. Knockdown was achieved using either siRNA or shRNA, as indicated in the table. Cells were treated with 20 nM siRNA for SMARCAL1 (Dharmacon 5’- UUUCACAGAGAAAUGCUUAUGCAGGU −3’) and/or 20 nM siRNA for ATRX (Invitrogen NM_000489.3 Stealth RNAi) on day 0, and again on day 4 after plating, using Lipofectamine RNAiMax. Other cell lines were infected with shATRX (Sigma MISSION TRCN0000342811) or treated with 2 ug/mL doxycycline to induce expression of shSMARCAL1 (Dharmacon SMARTvector inducible human SMARCAL1 hEF1α-TurboGFP shRNA). Viability was determined on day 7 using CellTiter-Glo assay (Promega). Each dot represents average of three biological replicates. p = 0.0308, unpaired t test. B) Relative viability of SMARCAL1-deficient cell lines NY and CAL78 following knockdown of ATRX and DAXX by CellTiter-Glo luminescence assay. Cells were treated with 20 nM siRNA for ATRX and/or DAXX (Dharmacon J-004420-08-0100) on day 0 and day 4 after plating. Viability was determined on day 7 using CelllTiter-Glo assay. Bars represent mean with standard deviation. n = 6 for NY, n = 3 for CAL78. ** p < 0.01, **** p < 0.0001, ordinary one-way ANOVA with Tukey’s multiple comparisons tests.