Accurate Identification of Leishmania Parasites in Sand Flies by Polymorphism Analysis of Cytochrome Oxidase Subunit 2 Gene Using Polymerase Chain Reaction and Quantitative PCR-High Resolution Melting Techniques in Iranian Border with Iraq

Abstract

Background: Firmly identification of Leishmania in Phlebotomus papatasi and understanding of natural transmission cycles of parasites in sand flies are important for treatment and local control.

Methods: Modified and developed method of High Resolution Melting (HRM) as a preferable technique was employed to accurate identification of Leishmania in sand flies from Iranian border with Iraq, by targeting cytochrome oxidase II (COII) gene and designing suitable primers. PCR products cloned into pTG19-T vector, then purified plasmid concentration was measured at 260 and 280nm wavelength. The melting curve plots were generated and DNA sequences were analyzed using Sequencher 3.1.1, CLC Main Workbench 5.5, MEGA 6, DnaSP5.10.01 and MedCalc® version 13.3.3 soft wares.

Results: Among about 3000 collected sand flies, 89 female Ph. papatasi were identified and two with L. major. In amplified fragment of COII gene among 611bp, 452bp had no genetic variations with low polymorphic sites (P= 0.001) and high synonymous (79.8%) as compare to non-synonymous sites (20.2%). Leishmania major was discriminated in Ph. papatasi with 0.84 °C melting temperature (T_m) and unique curve based on thermodynamic differences was an important criterion using HRM technique.

Conclusion: Subsequent war in Iraq made a high risk habitat for parasites transmission. It is important to discover accurate diagnostic procedures for leishmaniasis control.

Keywords: Cloning; Cytochrome oxidase II; qPCR-HRM.

Fig. 1.

Geographical location of Ilam Province, and sampling sites

Fig. 2.

Phlebotomus papatasi female, A: unfed, B: Fed, C: Gravid, D: Semi gravid

Fig. 3.

A: Two Leishmania infection were detected by PCR. The sequences were identified as L. major based on sequencing. −ve: Negative control, +ve: Positive control, M: Markers (100bp left). B: COII gene was cloned in the pTG19-T vector. Plasmids were extracted and serial dilution of them were prepared. M: Markers (1000bp right, 100bp left). 1: PCR products with COII primers for plasmid including COII in L. tropica with 611bp, 2: PCR products with COII primers for plasmid including COII in L. major with 607bp, 3: PCR products with M13 primers for plasmid including COII in L. major with 800bp, 4: Plasmid extraction products contains COII gene in L. major with 3500bp, 5: Plasmid extraction products contains COII gene in L. tropica with 3500bp, 6: Plasmid without pTG19-T vector with 2880bp

Fig. 4.

A: Based on obtained sequences and polymorphism analysis results, forward and reverse primers were designed for qPCR of COII gene. CO.A.R470.2 (F: TGGAGAAACAACAATATTTAGTAA, R: CCTAAACTTGAAATTGCAAATG) B: Schematic illustration of COII gene, amplified with specific primers (small black arrows) for Leishmania species using CLC bioinformatics software (8)

Fig. 5.

Phylogenetic analyses discriminated Leishmania species well. A: Phylogenetic tree based on the mitochondrial nucleotides (COII gene) drawn by Maximum Likelihood method. B: Phylogenetic tree based on the mitochondrial genetic amino acid codes, drown by Maximum Likelihood method

Fig. 6.

Specifications performance of Leishmania detection by qPCR validation. Amplification plots derived from serial dilutions of cultured parasites (L. major and L. tropica standards with R and F CO.A.470.2 primers), ranging from 20–2× 10⁷ copies / reaction plasmids by qPCR

Fig. 7.

Melting temperatures and normalized melting profiles obtained with the HRM assays for L. major and L. tropica. A: Derivative melt curves, B: Aligned and normalized melt curves, C: Differences melt curves