TLR7/8 activation induces autoimmune vasculopathy and causes severe pulmonary arterial hypertension

Abstract

This study introduced a combination of autoimmune stimuli (TLR-7/8 agonist) and endothelial injury (Sugen) and established a novel rat model representing immune–vascular pathological events mimicking human PAH associated with autoimmune disorders https://bit.ly/3P3H5V0

FIGURE 1

R848-SU5416 (R-SU) rat model of pulmonary hypertension. a) R-SU is established by combination of topical R848 application (1.67 mg·kg⁻¹ three times per week for 5 weeks) on the rat ears and single subcutaneous injection of SU5416 (20 mg·kg⁻¹). Immunohistochemical analysis demonstrated a focal accumulation of CD103⁺ cells at the epidermal–dermal junction of ear where R848 was applied (arrow); mRNA expressions of interferon (IFN) A1, IFNB1, toll-like receptor 7 (TLR7) and TLR8 were increased in the spleen (n=6), suggesting the involvement of plasmacytoid dendritic cells (pDCs) in response to TLR7/8 activation. The TLR7-driven autoimmunity perpetuates SU5416-induced injurious stimuli in the pulmonary vasculatures and eventually causes obliterative vascular remodelling. b) Mean pulmonary arterial pressure (mPAP); c) right ventricle (RV) hypertrophy calculated by Fulton's index as the weight ratio of RV to left ventricle (LV)+septum; d) percentages of muscularised pulmonary vessels in R-SU rats. Ctrl: healthy control; R848: R848 treated alone; SU: SU5416 treated alone; 5W: 5-week R848+SU5416 treated rats; 7W: 7-week R848+SU5416 treated rats. n=6. e) RV ejection fraction (RVEF) from different time points (2-week (2W), 5-week (5W), 7-week (7W)) of the same R-SU, measured by cardiac magnetic resonance imaging. n=6. f) Histological examination demonstrates infiltration of inflammatory cells and vascular remodeling in R-SU rat lungs. Haematoxylin and eosin (H&E) staining shows prominent bronchus-associated lymphoid tissues (arrows) around pulmonary vessels; CD68 staining macrophages; CD117 and Toluidine blue (TB) staining mast cells; Elastic Van Gieson (EVG) staining shows occlusive vascular lesions; von Willebrand factor (vWF) staining endothelial cells; smooth muscle actin (SMA) staining smooth muscle cells; Ki67 staining proliferating cells; double immunofluorescence staining with CD31/Ki67, CD31/SMA and SMA/Ki67; Masson's Trichrome (MT) staining connective tissues. g) Protein expression in R-SU rat lungs assessed by Western blotting. The data were generated from optical density measurements of individual bands normalised to GAPDH (pSTAT3 to total STAT3; active MMP2/9 to pro MMP2/9) and presented as fold change relative to control group. n=6. h) Proteom cytokine profiles in R-SU rat serum using R&D systems Panel A. Serum of six individual rats per group equally contributed to the pooled samples to incubate the profiler membranes. The experiment was duplicated with separate sample preparations. The data were generated from optical density measurements of individual dots and normalised to reference spots on each membrane, and presented as fold change relative to control group. i) Enlarged spleen from R-SU rats compared with controls, the quantification was accessed by the weight ratio of spleen over body weight; Ctrl: 2.04±0.22×10⁻³ versus R-SU: 8.50±1.31×10⁻³ (p<0.001). Periodic acid Schiff (PAS) stained kidney sections from R-SU rats reveal glomerulonephritis. j) Fluorescence-activated cell sorting analysis of peripheral mononuclear cells from R-SU rats shows increased frequencies of CD3⁻CD4⁺CD11b/c^lowMHC class II⁺ cells, referring activated pDCs, and an increased ratio of Th17 (defined by CD3⁺CD4⁺IL17A⁺) to Treg cells (defined by CD3⁺CD4⁺CD25⁺Foxp3⁺). n=6. k) Plasma levels of autoantibodies: anti-nuclear antibody (ANA), anti-double stranded DNA antibody (anti-dsDNA) and anti-endothelial cell antibody (AECA) in R-SU rats detected by ELISA. Ctrl: healthy control; 5W: 5-week R-SU rats; 7W: 7-week R-SU rats. n=6. All values are presented as mean±sem. Differences were assessed by one-way ANOVA (multiple groups) or unpaired t-test (two groups). *: p<0.05; **: p<0.01; ***: p<0.001. Primers used in qRT-PCR: IFNA1 (F-CAGCAGATCCAGAAGDCTCAARC;R-CAGGCACAGGGRCTGTGTTT), IFNB1 (F-TGCTGTGCTTCTCCACCACT;R-TAGTCTCATTCCACCCAGTGCT), TLR7 (F-TTTCCCAGAGCATACAGCTCAG;R- CACTCAAGGACAGAACTGCTGC), TLR8 (F:CCAGAGTCTTCCAAACTTGGCAAC;R-CAAGGCCTTGCCATAAGCAGTACA).