The Product of the Fission Yeast fhl1 Gene Binds to the HomolE Box and Activates In Vitro Transcription of Ribosomal Protein Genes

Abstract

Fission yeast ribosomal protein genes (RPGs) contain a HomolD box as a core promoter element required for transcription. Some of the RPGs also contain a consensus sequence named HomolE, located upstream of the HomolD box. The HomolE box acts as an upstream activating sequence (UAS), and it is able to activate transcription in RPG promoters containing a HomolD box. In this work, we identified a HomolE-binding protein (HEBP) as a polypeptide of 100 kDa, which was able to bind to the HomolE box in a Southwestern blot assay. The features of this polypeptide were similar to the product of the fhl1 gene of fission yeast. The Fhl1 protein is the homolog of the FHL1 protein of budding yeast and possesses fork-head-associated (FHA) and fork-head (FH) domains. The product of the fhl1 gene was expressed and purified from bacteria, and it was demonstrated that is able to bind the HomolE box in an electrophoretic mobility assay (EMSA), as well as being able to activate in vitro transcription from an RPG gene promoter containing HomolE boxes upstream of the HomolD box. These results indicate that the product of the fhl1 gene of fission yeast can bind to the HomolE box, and it activates the transcription of RPGs.

Keywords: Fhl1 protein; HomolD box; HomolE box; RPGs transcription.

Figure 1

Fission yeast whole-cell extracts contain a HomolE-box-binding protein. Fission yeast whole-cell extracts were prepared as described in the Materials and Methods, and 5 µL of protein (50 μg) was incubated with an end-labeled oligonucleotide containing two HomolE boxes (see Section 4). Complexes were separated by electrophoreses in a 5% polyacrylamide gel in TBE buffer. Lane 1 does not contain protein, and lane 2 contains a fission yeast whole-cell extract. Lane 3 contains a whole-cell extract plus 50 ng of double-stranded cold (unlabeled) mutated HomolE oligonucleotide competitor (mHE; TTCGTTGAGtGTAGtGTTGC), while lane 4 contains 50 ng of double-stranded cold HomolD (HD; TGAAAACAGTCACATTTTAC) oligonucleotide competitor. Lanes 5–7 contain increasing amounts (12.5, 25, and 50 ng, respectively) of double-stranded cold wild-type HomolE (HE; TTCGTTGAGGGTAGGGTTGC) oligonucleotide competitors. Proteins and cold competitors were pre-incubated for 15 min in the reaction buffer before adding the labeled probe. The assay conditions with the cold competitors were similar to the reactions without oligonucleotide competitors.

Figure 2

Purification of the HomolE-box-binding protein (HEBP): (A) Fission yeast whole-cell extracts were fractionated by chromatography (see Section 4) according to the scheme. (B) Electrophoretic mobility assay of the last purification step (Poros-S column), showing the binding activity to the labeled HomolE probe. The Input lane shows the binding activity from the hydroxyapatite column, and the WCE lane shows the binding of the crude whole-cell extract. The column fractions (10–15) were assayed, and those fractions with binding activity (12–14) were pooled and further analyzed. (C) SDS-PAGE analysis of the pooled fractions from (B). Three micrograms (3 μg) of protein was analyzed in an 8% SDS-PAGE gel followed by Coomassie Blue R-250 staining. The arrow shows the major 100 kDa polypeptide present in the fraction.

Figure 3

Southwestern blot analysis of the fractions from the Poros-S column. Proteins were separated on an 8% SDS-PAGE gel and transferred to Immobilon-P membranes. After protein renaturation, the membranes were incubated with labeled probes, washed, and exposed to an X-ray film. Panel (A) shows the autoradiography of a membrane incubated with a mutant HomolE probe (mHE), while panel (B) shows the autoradiography of a membrane incubated with a wild-type HomolE probe (HE). The amounts of loaded protein from the Poros-S column (1 and 5 μg, respectively) are shown at the top. The MW markers are shown on the left side of the figure. The arrow indicates the polypeptide that binds the HomolE box.

Figure 4

Schematic representation of the Fhl1 protein. The fhl1 encodes the fission yeast Fhl1 protein, which has 743 amino acids and a calculated molecular weight of 81.13 kDa. The protein possesses a fork-head-associated (FHA, blue) domain (from amino acids 39 to 119) and a fork-head (FH, red) domain (from amino acids 291 to 368).

Figure 5

The fission yeast Fhl1 protein binds to HomolE. The gene encoding the fission yeast Fhl1 protein was cloned in a bacterial expression vector, and the recombinant protein was purified by NTA-Ni-agarose affinity chromatography. (A) Analysis of 200 ng of the recombinant protein in an 8% SDS-PAGE gel, followed by silver staining. On the left side, the MW markers are shown. The arrow shows the Fhl1 protein. (B) Electrophoretic mobility shift analysis of the recombinant fission yeast Fhl1 protein. Assays were performed with 10 ng of the purified protein using the end-labeled HomolE probe and poly (dG-dC) as a non-specific competitor. Lane 1 does not contain protein. Lanes 2 and 8 contain recombinant Fhl1 protein. Lane 3 contains recombinant protein plus 50 ng of cold mutant HomolE (mHE) oligonucleotide, while lane 4 contains recombinant Fhl1 protein plus 50 ng of cold TATA oligo. Lanes 5–7 contain recombinant Fhl1 protein and 12.5, 25, and 50 ng of cold HomolE (HE) oligonucleotide, respectively. Lane 9 contains recombinant Fhl1 protein plus 50 ng of cold HomolD (HD) oligonucleotide. The assay conditions with the oligonucleotide competitors were similar to those described in Figure 1.

Figure 6

Recombinant Fhl1 protein can activate in vitro transcription: (A) Transcription assay using templates containing two mutated HomolE boxes (mHE) or two wild-type HomolE boxes (HE) upstream of a HomolD box. Transcription assays were carried out using 5 µL (50 μg) of fission yeast WCE. Lanes 1–3 contain the mHE promoter. In lane 1, the Fhl1 protein was not added, while lanes 2 and 3 contain 20 and 40 ng of recombinant Fhl1 protein, respectively. Lanes 4–7 contain the HE promoter, and lanes 4–6 contain 10, 20, and 40 ng of recombinant Fhl1 protein, respectively. Lane 7 does not contain recombinant Fhl1 protein. (B) A plot displaying the quantification from (A).