SLG2 specifically regulates grain width through WOX11-mediated cell expansion control in rice

Abstract

Grain size is specified by three dimensions of length, width and thickness, and slender grain is a desirable quality trait in rice. Up to now, many grain size regulators have been identified. However, most of these molecules show influence on multi-dimensions of grain development, and only a few of them function specifically in grain width, a key factor determining grain yield and appearance quality. In this study, we identify the SLG2 (SLENDER GUY2) gene that specifically regulates grain width by affecting cell expansion in the spikelet hulls. SLG2 encodes a WD40 domain containing protein, and our biochemical analyses show that SLG2 acts as a transcription activator of its interacting WOX family protein WOX11. We demonstrate that the SLG2-associated WOX11 binds directly to the promoter of OsEXPB7, one of the downstream cell expansion genes. We show that knockout of WOX11 results in plants with a slender grain phenotype similar to the slg2 mutant. We also present that finer grains with different widths could be produced by combining SLG2 with the grain width regulator GW8. Collectively, we uncover the crucial role of SLG2 in grain width control, and provide a promising route to design rice plants with better grain shape and quality.

Keywords: GW8; SLG2; WOX11; cell expansion; grain width; rice.

Figure 1

Characterization of the slg2 mutant. (a–d) Comparison of grain width (a), grain length (b), grain thickness (c) and grain quality (d) between slg2 and WT. Bars = 5 mm. (e, f) Statistical analysis of grain size (e) and 1000‐grain weight (f) between slg2 and WT. Data are means ± SD (n = 30 for e and 3 for f). ***: P < 0.001, ns: no significant difference (Student's t test). (g–i) SEM observation of outer glume surfaces (g) and statistical analysis of cell number (h) and cell size (i) in slg2 and WT. For (g), bars = 500 μm for the left images, and 50 μm for the right images. Data are means ± SD (n = 5 for h and 50 for i). ***: P < 0.001, ns: no significant difference (Student's t test). (j–l) Cross‐sections of the spikelet hulls (j) and statistical analysis of cell number (k) and cell area (l) in slg2 and WT. The spikelet hulls are sampled before anthesis. In (j), the dotted line indicates the sites of the cross‐sections shown in middle, and the boxes indicate the sites of the magnified images shown in left. Bars = 1 mm (left), 500 μm (middle) and 50 μm (right). Data are means ± SD (n = 5 for k and 50 for l). ***: P < 0.001, ns: no significant difference (Student's t test). (m) Expression analysis of cell expansion genes in slg2 and WT. RNA isolated from young panicles of 2–3 mm in length is used for RT‐qPCR. OsActin is used as the internal control. The transcript levels are normalized against WT, which is set to 1. Data are means ± SD (n = 3). **: P < 0.01, ns: no significant difference (Student's t test).

Figure 2

Map‐based Cloning of SLG2. (a, b) Identification of the SLG2 candidate gene. Indicating one C‐T point mutation occurred in LOC_Os02g18820 in the slg2 mutant, which generates a premature stop codon. (c, d) Phenotypes of whole plant and grain size of WT, slg2, complementation lines (slg2‐C) and knockout lines (SLG2‐KO). Bars = 15 cm for whole plant and 5 mm for grain size. (e) Expression analysis of SLG2 in various rice tissues. For RT‐qPCR, RNA is isolated from shoots and roots of 7‐day‐old seedlings, and flag leaf blade, flag leaf sheath, culm, young panicle (2–3 mm in length) and mature floret before anthesis. OsActin is used as the internal control. Data are means ± SD (n = 3). (f) Subcellular localization of SLG2. Bars = 10 μm.

Figure 3

SLG2 and WOX11 interact and regulate rice seedling development. (a–c) Interaction assay between SLG2 and WOX11. Bars = 10 μm (b). (d) Morphological comparison of 7‐day‐old seedlings of WT, slg2, WOX11 knockout line (WOX11‐KO) and slg2,wox11 double mutant plants. Bar = 4 cm. (e, f) Statistical analysis of root length (e) and crown root number (f) of WT, slg2, WOX11‐KO, and slg2,wox11. Statistical analysis is performed in seedlings shown in (d). Bars followed by different letters represent significant difference at 5%. (g, h) Expression analysis of genes involved in shoot (g) and root (h) development. RNA isolated from the shoots and roots of the seedlings shown in (a) is used for RT‐qPCR. OsActin is used as the internal control. Data are means ± SD (n = 3). Bars followed by different letters represent significant difference at 5%.

Figure 4

The wox11 mutant displays slender grain phenotype similar to slg2. (a) Creation of WOX11 knockout transgenic line by the CRISPR‐Cas9 genome editing system. The target site is red‐underlined. The representative transgenic lines (abbreviated as WOX11‐KO1 and WOX11‐KO2, respectively) are generated in ZY66 genetic background. The dashes indicate deleted nucleotides. (b) Plant morphology of WT, slg2, WOX11‐KO and slg2,wox11 at the maturation stage. Bar = 15 cm. (c, d) Comparison of grain width (c) and grain length (d) among WT, slg2, WOX11‐KO and slg2,wox11. Bars = 5 mm. (e) Statistical analysis of grain length and grain width in WT, slg2, WOX11‐KO and slg2,wox11. Data are means ± SD (n = 30). Bars followed by different letters represent significant difference at 5%. (f) Expression analysis of cell expansion genes in WT, slg2, WOX11‐KO and slg2,wox11. RNA isolated from young panicles of 2–3 mm in length is used for RT‐qPCR. OsActin is used as the internal control. The transcript levels are normalized against WT, which is set to 1. Data are means ± SD (n = 3). Bars followed by different letters represent significant difference at 5%.

Figure 5

SLG2 functions as an activator of WOX11 to regulate the transcription of downstream cell expansion genes. (a) Scanning of the WOX11 binding motif ‘TTAATGG/C’ across the whole genomic sequence of the cell expansion genes downregulated in slg2 and the WOX11‐KO lines. The length of promoter sequence is 2‐kb. (b) Schematic diagram of the constructs used for transactivation activity assay. (c) Analysis of the effect of SLG2 on the transactivation activity of WOX11. Data are means ± SD (n = 3). Bars followed by different letters represent significant difference at 5%. Indicating that SLG2 significantly enhances the transactivation activity of WOX11. (d) Transcription activation of WOX11 and SLG2 on OsEXPB7. Data are means ± SD (n = 3). Bars followed by different letters represent significant difference at 5%. Indicating the coordinate function of SLG2 and WOX11 in promoting the transcription of OsEXPB7. (e, f) WOX11 directly binds to the promoter of OsEXPB7, which is tested by yeast one‐hybrid assay (e) and electrophoretic mobility shift assay (EMSA) (f). The combinations pGAD53m‐p53HIS and pGAD424‐p53HIS are used as the positive and negative controls, respectively (e). In (f), the hot probe is a biotin‐labelled fragment of the OsEXPB7 promoter sequence AGGGATCGATCGAAATTAATGGCGGGCAGGAGCAGGA, and the cold probe is a non‐labelled competitive probe. The mutant probe is the labelled hot probe sequence with two nucleotides mutated in the conserved binding site (AGGGATCGATCGAAATCCATGGCGGGCAGGAGCAGGA).

Figure 6

Fine regulation of grain width by slg2, gw8 and their combination. (a) Creation of GW8 knockout transgenic line by the CRISPR‐Cas9 genome editing system. The target site is red‐underlined. The representative transgenic lines (abbreviated as GW8‐KO1 and GW8‐KO2, respectively) are generated in ZY66 (GW8‐KO^WT) and slg2 (GW8‐KO ^slg2 ) genetic background. The asterisks indicate inserted nucleotides and the dashes indicate deleted nucleotides. (b) Plant morphology of WT, slg2, GW8‐KO^WT and GW8‐KO ^slg2 at the maturation stage. Bar = 15 cm. (c, d) Comparison of grain width (c) and grain length (d) among WT, slg2, GW8‐KO^WT and GW8‐KO ^slg2 . Bars = 5 mm. (e) Statistical analysis of grain length and grain width in WT, slg2, GW8‐KO^WT and GW8‐KO ^slg2 . Data are means ± SD (n = 30). Bars followed by different letters represent significant difference at 5%.