Spotlight on the Expanding Role of miR-647 in Human Cancers

Abstract

MicroRNAs are a large group of small, non-coding ssRNAs (miRNAs) that have an epigenetically pivotal role in gene expression and other biological processes in cells and can be regarded as capable biomarkers for the early detection and management of cancer. The aim of the present review article is to summarize the evidence for recognizing the molecular mechanism, target genes, and clinical significance of miR-647 in different cancers. Multiple studies have demonstrated that aberrant expression of miR-647 could be found in a variety of malignancies, such as bladder cancer, cervical cancer, colorectal cancer, gastric cancer, glioma, hepatocellular carcinoma, non-small cell lung cancer, ovarian cancer, and prostate cancer have reported, notably, increase or decrease in expression of miR-647 so that it can function as a tumorigenic (oncomiR) or tumor suppressor gene. MiR-647 is effective in the proliferation, migration, and invasion of cancer cells by playing a function in cell cycle pathways. MiR-647 can be a valuable potential biomarker for assessing the extent of cancer, prognosis, and response to therapy and shows great therapeutic efficacy in different solid tumors. Moreover, serum concentrations of miR-647 are directly effective in decreasing overall survival and disease progression. So, an efficient therapeutic target can be the effect on miR-647 expression by antitumor drugs.

Keywords: Biomarker; cancer; miR-647; microRNA; microRNA-647.

Figure 1

Prediction of Optimal Secondary structure of the has-miR-647 (EPS format) with -42.70 kcal/mol with its dot-bracket notation using the Rfold web server. The sequence of this microRNA: AGGAAGTGTTGGCCTGTGGCTGCACTCACTTC CTTCAGCCCCAGGAAGCCTTGGTCGGGGGCAG GAGGGAGGGTCAGGCAGGGCTGGGGGCCTGAC