A novel invasive Streptococcus pyogenes variant sublineage derived through recombinational replacement of the emm12 genomic region

Abstract

Group A streptococcal strains potentially acquire new M protein gene types through genetic recombination (emm switching). To detect such variants, we screened 12,596 invasive GAS genomes for strains of differing emm types that shared the same multilocus sequence type (ST). Through this screening we detected a variant consisting of 16 serum opacity factor (SOF)-positive, emm pattern E, emm82 isolates that were ST36, previously only associated with SOF-negative, emm pattern A, emm12. The 16 emm82/ST36 isolates were closely interrelated (pairwise SNP distance of 0-43), and shared the same emm82-containing recombinational fragment. emm82/ST36 isolates carried the sof12 structural gene, however the sof12 indel characteristic of emm12 strains was corrected to confer the SOF-positive phenotype. Five independent emm82/ST36 invasive case isolates comprised two sets of genetically indistinguishable strains. The emm82/ST36 isolates were primarily macrolide resistant (12/16 isolates), displayed at least 4 different core genomic arrangements, and carried 11 different combinations of virulence and resistance determinants. Phylogenetic analysis revealed that emm82/ST36 was within a minor (non-clade 1) portion of ST36 that featured almost all ST36 antibiotic resistance. This work documents emergence of a rapidly diversifying variant that is the first confirmed example of an emm pattern A strain switched to a pattern E strain.

Figure 1

(a) Diagram of predicted recombination event resulting in an emm gene switch between an emm12/ST36 recipient and an emm82 emm gene donor strain. This genomic region is depicted from the emm12/ST36 strain with closest genetic relatedness to the emm82/ST36 cluster (isolate 20,197,993 shown in Fig. 2). The blue open reading frames are from the emm12 recipient that carries an inactive sof12 structural gene due to a single deleted base at position 2145 relative to the 14 emm82 progeny strains resulting in the truncated sof12’ and sof12″ open reading frames. Predicted crossover points within isp and htp resulted in the replacement of this entire 17.7 kb isp-htp pattern A-C emm12 region to a pattern E emm82 region. This double crossover event resulted in the transfer of emm-like genes (mrp82 and enn82) and fibronectin binding protein gene fbpA from the genetic donor (region from emm82/ST334 strain 20,154,608 depicted in donor strain) to replace emm12 and drs (distantly related sic gene) within the ST36 background. In addition, the disrupted sof12, highly conserved within the emm12/ST36 background, was converted to an active sof12 in the progeny due to the insertion of a single base at position 2145. The initial progeny (2 strains) carry the enn82 gene which is absent within the remaining 14 progeny strains. This deletion event is predicted to have occurred through recombination between the near-identical emm82 and enn82 3’ regions. The light gray crosses between sof and sfbX open reading frames depict conserved fibronectin-repeat and wall attachment motif regions. Similarly, light regions connecting emm and enn-like genes depict conserved 5’ and 3’ regions. (b) Same predicted recombination event as in Fig. 1a, employing emm82/ST314 strain PHE25159, which of available potential donor type emm82 strain genome sequences, has the highest flanking sequence homology to the progeny flanking the double crossover points. Numbers above and below depict percent identities over areas shown of the progeny to recipient and donor, respectively.

Figure 2

Core genomic maximum parsimony phylogenetic tree derived from short read genomes of 684 ST36 isolates including 667 invasive emm12 isolates, a single emm-deletion strain (20,160,179) and 16 isolates of the emm82 emm switch variant sublineage. Trees were generated from short read bacterial genome sequences employing kSNP3.0 with a kmer size of 19. The analysis involved 684 nucleotide sequences with a total of 5103 positions in the final dataset. Above right shows pairwise distance between the 16 emm82/ST36 isolates and 4 recipient lineage strains (shaded orange within the phylogram and the pairwise comparison). Two indistinguishable clusters accounting for 5 progeny isolates are highlighted in yellow and green in the phylogram and the SNP matrix. Isolates were recovered during 2015–2020 except for year 2021 emm82/ST36 strains 20,214,701, 20,214,050, 3A-102 and 3 emm12 strains recovered during 2007 and 2011. Each instance of the indicated resistance genes is indicated by color-coded arrowhead in the approximate region of the phylogram. The emm82 isolates are listed from their small branch with emm-family genes shown in red font, followed by prophage-encoded virulence factors, resistance gene indicators, state of isolation, and year of isolation. Hyphens indicate linkage of virulence or resistance determinants on the same accessory element. Positions of the 12 macrolide-resistant emm82 isolates and the 50 macrolide-resistant emm12 isolates are indicated by different arrowheads (47 clade 2 and 3 clade 1). The positions of the single emm12 isolate carrying the linked speK and slaA genes, and the two emm12 isolates carrying speA are indicated. Positions and lab identifiers of the emm-negative clade 1 strain 20,160,179, and three non-clade 1 emm12 trains are indicated.

Figure 3

Alignment of single contig genomes from recipient ST36 lineage and emm82/ST36 progeny strains. Each genome starts at the consensus site just upstream of the chromosomal replication initiator protein gene dnaA. Landmark virulence genes not associated with accessory elements are indicated in green font with indicated orientations noted for forward (top) and reverse (bottom) strands. Tandem repeated sequences flanking prophages or insertion elements are also indicated with number of bases and are listed below. The positions of uninterrupted genes corresponding to repeat sequences are indicated within some strains (tRNA23 corresponds to tRNA-arg in strain 20,185,322 and tRNA16 corresponds to tRNA-ser in strain 20,192,362). Accessory elements (Prophages or resistance elements) are indicated in red with relative orientations. The sof* designation refers to conserved inactive single base deletion sof12 derivative. Multiple genes separated by commas and are oriented with the bottom or top strand in direction and order of gene transcription. Conserved genomic sections are color coded. Major inverted genomic sections are indicated for strains 20,164,915, 20,192,362, and 20,154,051 relative to the 5 other strains in the alignment. Genome sizes are indicated at right end of each genome.Flanking repeat sequences and corresponding genes (alphabetical order): comEC2: GG, within comEC competence family protein gene. csn20: GCTATGCTGTTTTGAATGGT, downstream of CRISPR-associated protein gene csn2. hsdM3: GGG, within type I restriction/modification system protein gene hsdM. msrAB12:TATTATATCAGA, downstream of peptide methionine sulfoxide reductase genes msrA-msrB. nap24: TATGATGAACATGCAAAACATGAT, overlaps 5’ end (start codon underlined) of nucleoid-associated protein gene nap. pepD16: CATGTACAACTATACT, intragenic within pepD dipeptidase gene. rfb49: AAACTCAAGAAGTGATTAAATAAAACATTAAACAACCTTGTCATATCAA, 3′ 23 bases of rfbB/rmlB (dATP-glucose-4,6-dehydratase) and 26 bases of rfbB-mutT intergenic region. ssrA77:ATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTTencompassing one of 2 transcriptional terminators downstream of ssrA (tmRNA gene). tRNA16: AGGAGAGGAGGGGATT, overlaps exactly with 5’ end of tRNA-ser gene. tRNA23: GATTCCGGCAGGGGTCATTATTG, encompasses 3’ end of tRNA-arg gene. uvrA18: CTTATATTATAACAAAAA, downstream of excinuclease ABC subunit A protein gene uvrA.

Figure 4

(a) Alignment of prophages carrying speC/spd and sda from strain 20,200,554 The small blue arrowhead flanking each prophage indicate repeat sequences despicted in Fig. 3 and described in the Fig. 3 legend. (b) Alignment of prophages carrying speC/spd and sda from strains 20,200,554 and 20,164,915.

Figure 5

(a) Transposons harboring ermB in emm82/ST36 strains. A partial element carrying ermB and tetO was extracted from pharyngitis strain 3a102. (b) Element harboring composite prophage/transposon øTn1207 in strains 20,154,051(emm82/ST36) and 20,156,705(emm12/ST36) resistant to erythromycin and susceptible to clindamycin. The upper sequence depiction is derived from strain 2812A described in reference 40.