Akkermansia muciniphila - friend or foe in colorectal cancer?

Abstract

Akkermansia muciniphila is a gram-negative anaerobic bacterium, which represents a part of the commensal human microbiota. Decline in the abundance of A. muciniphila among other microbial species in the gut correlates with severe systemic diseases such as diabetes, obesity, intestinal inflammation and colorectal cancer. Due to its mucin-reducing and immunomodulatory properties, the use of probiotics containing Akkermansia sp. appears as a promising approach to the treatment of metabolic and inflammatory diseases. In particular, a number of studies have focused on the role of A. muciniphila in colorectal cancer. Of note, the results of these studies in mice are contradictory: some reported a protective role of A. muciniphila in colorectal cancer, while others demonstrated that administration of A. muciniphila could aggravate the course of the disease resulting in increased tumor burden. More recent studies suggested the immunomodulatory effect of certain unique surface antigens of A. muciniphila on the intestinal immune system. In this Perspective, we attempt to explain how A. muciniphila contributes to protection against colorectal cancer in some models, while being pathogenic in others. We argue that differences in the experimental protocols of administration of A. muciniphila, as well as viability of bacteria, may significantly affect the results. In addition, we hypothesize that antigens presented by pasteurized bacteria or live A. muciniphila may exert distinct effects on the barrier functions of the gut. Finally, A. muciniphila may reduce the mucin barrier and exerts combined effects with other bacterial species in either promoting or inhibiting cancer development.

Keywords: Akkermanisa municiphila; colorectal cancer; intestinal inflammation; mucin-reducing bacteria; probiotic.

Figure 1

Live and pasteurized A. muciniphila differentially upregulate mucins expression in the gut. C57Bl/6 mice were housed in SPF conditions at the Animal Facility of the Center for Precision Editing and Genetic Technologies for Biomedicine, EIMB RAS (under the contract #075-15-2019-1660 from the Ministry of Science and Higher Education of the Russian Federation). At the age of 5-6 weeks animals of both sexes were randomly distributed between the groups and used in the experiments described below. All manipulations with animals were carried out in accordance with the protocol approved by the Bioethics Committee of the EIMB RAS (Protocol No. 3 from 27/10/22). A. muciniphila was grown anaerobically in the medium supplemented with porcine mucin (Sigma) and hemin (Sigma). The bacterial solution was collected at the concentration 7-8×10⁷ CFU/mL, aliquoted by 1 mL and frozen at -80°C. (A) Scheme of experiment. To analyze the effect of bacteria inoculation on the gene expression at steady state C57Bl/6 WT mice were randomized into three groups of 7-9 individuals and then subjected to daily per os administration with PBS, 1.5×10⁸ CFU of pasteurized (70°C, 30 min) A. muciniphila or 1.5×10⁸ CFU of live A. muciniphila during 3 weeks. Fresh frozen in liquid nitrogen small intestine and colon were mechanically homogenized and lysed in ExtractRNA reagent (Evrogen, Russia). RNA was isolated by guanidinium thiocyanate-phenol-chloroform method following the manufacturer’s protocol. RNA was reverse-transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo, USA) followed by quantitative real-time PCR. qPCRmix-HS SYBR+LowROX (5X) (Evrogen, Russia). Gene expression analysis was performed using Quant Studio 6 (Applied Biosystems. USA) and the following primer set: Actb (F: GCGCTCTTTCAGCCTTCTTT; R: TGGCATAGAGGTCCTTGCG), Muc1 (F: TCGTCTATTTCCTTGCCCTG; R: ATTACCTGCCGAAACCTCCT), Muc2 (F: CCCAGAAGGGACTGTGTATG; R: TTGTGTTCGCTCTTGGTCAG), Muc3 (F: TGGTCAACTGCGAGAATGGA; R: TACGCTCTCCACCAGTTCCT), Muc4 (F: GTCTCCCATCACGGTTCAGT; R: TGTCATTCCACACTCCCAGA). Reactions were run using the following program on the Applied Biosystems 7500: 95°C for 10 min, 40 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec. (B) Relative expression level of Muc1, Muc2, Muc3 and Muc4 in colon and small intestine was normalized using Actb and calculated as 2^-ddCt fold change in experimental to control group (51). Each point in a diagram represents a single mouse; mean ± SD. *P < 0,05; **P < 0,01; ***P < 0,001; ns - not significant. One-way ANOVA test was used. (C) A. muciniphila in the gut inflammation and homeostasis.