STAT5 Is Necessary for the Metabolic Switch Induced by IL-2 in Cervical Cancer Cell Line SiHa

Abstract

The tumor cells reprogram their metabolism to cover their high bioenergetic demands for maintaining uncontrolled growth. This response can be mediated by cytokines such as IL-2, which binds to its receptor and activates the JAK/STAT pathway. Some reports show a correlation between the JAK/STAT pathway and cellular metabolism, since the constitutive activation of STAT proteins promotes glycolysis through the transcriptional activation of genes related to energetic metabolism. However, the role of STAT proteins in the metabolic switch induced by cytokines in cervical cancer remains poorly understood. In this study, we analyzed the effect of IL-2 on the metabolic switch and the role of STAT5 in this response. Our results show that IL-2 induces cervical cancer cell proliferation and the tyrosine phosphorylation of STAT5. Also, it induces an increase in lactate secretion and the ratio of NAD+/NADH, which suggest a metabolic reprogramming of their metabolism. When STAT5 was silenced, the lactate secretion and the NAD+/NADH ratio decreased. Also, the expression of HIF1α and GLUT1 decreased. These results indicate that STAT5 regulates IL-2-induced cell proliferation and the metabolic shift to aerobic glycolysis by regulating genes related to energy metabolism. Our results suggest that STAT proteins modulate the metabolic switch in cervical cancer cells to attend to their high demand of energy required for cell growth and proliferation.

Keywords: IL-2; NAD+/NADH ratio; STAT5; cervical cancer; lactate; metabolic switch.

Figure 1

The IL-2 receptor is present in cervical cancer cells, and cell proliferation increases in response to IL-2. The expression of the IL-2 receptor was evaluated in SiHa and HeLa cell lines by flow cytometry (A). Also, the presence of STAT5 was evaluated in both cell lines by flow cytometry (B). Cells were treated with 10 or 100 IU/mL of IL-2 for different times, and their proliferation was evaluated by the violet crystal colorimetric assay (C). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Figure 2

STAT5 tyrosine phosphorylation increases in response to IL-2. SiHa cells were treated with 10 IU/mL or 100 IU/mL of IL-2 for the indicated time points and tyrosine phosphorylation of STAT5 was evaluated by flow cytometry. The proportion of cells showing phosphorylated STAT5 is indicated as percentage. * p < 0.05, ** p < 0.01 and *** p < 0.001.

Figure 3

IL-2 modulates lactate secretion in the cervical cancer cell line SiHa. Cells were treated with 10 IU/mL (A) or 100 IU/mL (B) of IL-2 for different times and lactate secretion was evaluated using a commercial Lactate Assay Kit. The absorbance was measured at 570 nm. *** p < 0.001; **** p < 0.0001.

Figure 4

IL-2 increases the NAD+/NADH ratio in the cervical cell line SiHa. Cells were treated with 10 IU/mL (A) or 100 IU/mL (B) of IL-2 for different times, and NAD+ or NADH production was evaluated using a commercial NAD+/NADH Quantitation Kit. The absorbance was measured at 450 nm. ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Figure 5

Genes related to energy metabolism are modified in response to IL-2 in the cervical cell line SiHa. The expression of HIF and GLUT1 was evaluated by RT-PCR. Cells were treated with 10 IU/mL (A,C) or 100 IU/mL (B,D) of IL-2 for different times. Protein levels were evaluated by flow cytometry (E,F). Densitometric analysis for the time-course of gene expression is shown for each gene as relative expression. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. The following primers were used: HIF1α Forward CCA GAA GAA CTT TTA GGC CGC, Reverse TGT CCT GTG GTG ACT TGT CC; GLUT1 Forward GGA CAG GCT CAA AGA GGT TAT G, Reverse AGG AGG TGG GTG GAG TTA AT. The statistical analysis for three different flow cytometry assays are shown in Supplementary Figure S1.

Figure 6

Effect of STAT5 silencing on cell proliferation and STAT5 phosphorylation. STAT5 was silenced using an shRNA and the effect of the knockdown was evaluated by RT-PCR (A), Western blot (B) and flow cytometry (D). Also, the phosphorylated form of STAT5 in response to IL-2 treatment was evaluated by flow cytometry, and the proportion of cells showing phosphorylated STAT5 is indicated as percentage (E). Siha cell line was transfected with RNA scrambled, and we evaluated the effect in the expression of different genes (F). Cells were incubated in the presence of IL-2 for different times, and proliferation was evaluated using the violet crystal colorimetric assay (C). ** p < 0.01; **** p < 0.0001.

Figure 7

The production of lactate and the NAD+/NADH ratio decreased after STAT5 knockdown. The shSiHa subclone was incubated in the presence of IL-2 for different times, and the lactate secretion (A,B) and NAD+/NADH (C,D) ratio were evaluated using commercial kits as indicated. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Figure 8

STAT5 regulates the expression of RNA (A) or proteins (B) of genes related to the metabolic switch in the cervical cancer cell line SiHa. In the shSiHa subclone, the expression of RNA of genes (A) related to energy metabolism was evaluated by RT-PCR. The expression of actin was used as an internal control for RT-PCR. Densitometric analysis for gene expression is shown for each gene as relative expression. ** p < 0.01; **** p < 0.0001. The following primers were used: HIF1a Forward GACAAGCCACCTGAGGAGAG, Reverse GTGGCAACTGATGAGCAAGC; GLUT1 Forward GAACTCTTCAGCCAGGGTCC, Reverse TCACACTTGGGAATCAGCCC; PDK1 Forward AAGTTCATGTCACGCTGGGT, Reverse GCATCTGTCCCGTAACCCTC; STAT5 Forward GGTGAAGGCCACCATCATCA, Reverse GTACTCCATCACGCAGCAGT. To complement these results, we analyzed the presence of HIF-1α and GLUT1 proteins by flow cytometry (B).