Regulation of expression of the human interferon gamma gene

Abstract

DNA fragments isolated from a genomic clone of human gamma interferon (IFN-gamma) as well as IFN-gamma cDNA were used to map potential regulatory regions of the IFN-gamma gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-gamma gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-gamma gene. No hypersensitivity was found in the 3' regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-gamma, is 83% homologous to a nearly identical sequence in the 5' flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.