Multiple Tumors in a Patient with Interleukin-2-Inducible T-Cell Kinase Deficiency: A Case Report

Abstract

Immune dysregulation in Inborn Errors of Immunity (IEI) shows a broad phenotype, including autoimmune disorders, benign lymphoproliferation, and malignancies, driven by an increasing number of implicated genes. Recent findings suggest that childhood cancer survivors (CCSs) may exhibit immunological abnormalities potentially linked to an underlying IEI, along with a well-known increased risk of subsequent malignancies due to prior cancer treatments. We describe a patient with two composite heterozygous pathogenic variants in the interleukin-2-inducible T-cell kinase (ITK) gene and a history of multiple tumors, including recurrent Epstein-Barr virus (EBV)-related nodular sclerosis and Hodgkin's lymphoma (NSHL), associated with unresponsive multiple hand warts, immune thrombocytopenia, and an impaired immunological profile (CD4+ lymphocytopenia, memory B-cell deficiency, reduction in regulatory T-cells, and B-cell- and T-cell-activated profiles). In our case, ITK-related immune dysregulation and prior exposure to oncological treatments seem to have simultaneously intervened in the same individual, leading to the development of a unique clinical profile. It is essential to raise awareness of the two-way association between immune dysregulation disorders and multiple tumors.

Keywords: ITK deficiency; case report; childhood cancer survivors (CCS); inborn error of immunity (IEI); multiple tumors.

Figure 1

Family tree (narrow and red: patient case, blue color: relatives with a history of oncological condintions).

Figure 2

Clinical oncological timeline. Abbreviations: CTX (chemotherapy), RT (radiotherapy), SX (surgery), NSHL (nodular sclerosis Hodgkin lymphoma), RL (relapse), HSCT (hematopoietic stem cell transplantation), GCTST (giant cell tumor of soft tissues), UPS (undifferentiated pleomorphic sarcoma), MEC (mucoepidermoid carcinoma), GPF (giant pendulous fibroma), NBCC (nodular basal cell carcinoma), ML (adrenal myelolipoma).

Figure 3

Sanger sequencing electropherograms of plasmids (Clone A and Clone B) containing ITK PCR products encompassing exons 11–16 (824 bp) showing that two mutations, c.1003C>T and c.1664delG, are in trans since that the plasmid containing the allele harboring one mutation is wild-type (wt) for the second one. Methods: Total RNA was isolated from whole blood using PAXgene blood RNA tubes (Quiagen, Hilden, Germany) using the nucleic acid purification kit (PAXgene Blood RNA Kit, Quiagen, Hilden, Germany) according to the standard procedures. Reverse transcription to cDNA was carried out in a 20μL reaction mixture with the use of SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Moreover, 10 μL of synthesized cDNA was used to amplify the ITK coding region encompassing exons 11–16, which include both mutations (the ITK c.1003C>T and ITK c.1664delG) with the following primers: ITK-10F: ATCACCAACATAATGGAGGAG; ITK-16R: CTCTTTCCAGCAGTGATTC.RT-PCR products were analyzed by electrophoresis on 2% agarose gels and viewed by ethidium bromide staining. RT-PCR products isolated by agarose gel were purified and cloned into the TA cloning vector pGEM-T (Promega, Madison, WI, USA) to transform E. coli JM109-competent cells. Transformants were picked up and grown over night. Plasmid DNA was extracted with a Quiagen Plasmid Mini kit (Quiagen, Hilden, Germany) and sequenced using specific ITK primers by utilizing the BigDye Terminator v 3.1 Cycle Sequencing kit (Thermo Fisher Scientific, Waltham, MA, USA).

Figure 4

Hand warts of the patient.

Figure 5

EBER ISH stain of lymphoma tissue (original magnification of 200×). This image shows an EBER in situ hybridization (ISH) stain of a lymphoma tissue sample. Neoplastic cells appear stained in brown, indicating positivity for Epstein–Barr virus-encoded RNA (EBER). This suggests the presence of EBV infection in these cells. Surrounding lymphatic cell results are negative for EBER.