The Molecular Mechanism of Interaction Between SEPALLATA3 and APETALA1 in Arabidopsis thaliana

Abstract

Flower formation has been a primary focus in botanical research, leading to the identification of multiple factors regulating flowering over the past 30 years. The MADS transcription factors SEPALLATA3 (SEP3) and APETALA1 (AP1) are essential for floral meristem development and organ identity. In Arabidopsis, SEP3 functions as a central integrator, combining MADS proteins into a tetrameric complex, with its interaction with AP1 playing a key role in sepal and petal formation. This research explores AtSEP3 and AtAP1, with particular emphasis on the Leu residue in the K1 subfunctional domain of AtSEP3, which is necessary for their interaction. A predicted structural model of AP1 was used, followed by protein docking with SEP3, which indicated that Leu residues at positions 115 and 116 are critical binding sites. Mutations at these position were examined through yeast two-hybrid assays and other techniques, identifying Leu 116 as a significant site. Subsequent purification and EMSA analysis revealed that mutations in the leucine zipper of SEP3 decreased its DNA binding ability. Observations of transgenic plants showed that disruption of AtSEP3 and AtAP1 interaction resulted in extended vegetative growth, increased size and number of rosette leaves, and modifications in floral structures. This study offers new insights into the interaction mechanism between AP1 and SEP3 during flowering.

Keywords: AtAP1 gene; AtSEP3 gene; K1 subdomain; petal; protein interaction; site‐specific mutation.

FIGURE 1

Sequence comparison plot of single point mutations.

FIGURE 2

Sequence comparison plot of multiple point mutations.

FIGURE 3

Yeast two‐hybrid diagram of AtSEP3 carrying multipoint mutation and AtAP1. These mutations included single‐site mutations (Leu to Ala at position 99), double‐site mutations (Leu to Ala at positions 99 and 101), triple‐site mutations (Leu to Ala at positions 99, 101, and 108), four‐site mutations (Leu to Ala at positions 99, 101, 108, and 115), and five‐site mutations (Leu to Ala at positions 99, 101, 108, 115, and 116).

FIGURE 4

Yeast two‐hybrid diagram of AtSEP3 carrying single point mutation, AtSEP3.3 and AtAP1. These mutations included single‐site mutations (Leu to Ala at position 99, 101, 108, 115, and 116).

FIGURE 5

The galactosidase activity test results. (A) Interaction between AtAP1 and AtSEP3 carrying multipoint mutations, AtSEP3.3. (B) Interaction between AtSEP3 carrying single point mutation and AtAP1.

FIGURE 6

Fluorescence complementation (BiFC) assay of the interaction between the proteins encoded by AtSEP3, AtSEP3‐T5, and AtAP1.

FIGURE 7

EMSA results of DNA probe binding to AtSEP3, AtSEP3‐DT5, and AtSEP3‐T5. The purified protein was bound to the probe (TTTTCTAGGGCTTCCATTTTTGGATT TTTTGATTAGCC) at room temperature. The first lane is the blank probe, the second lane is the binding band of the labeled probe to the mutant SEP3‐T5 protein, the third lane incorporates the wild‐type SEP3 protein and the labeled and unlabeled AP1 probes, the fourth lane is the dimerization band formed by the binding of the wild‐type SEP3 protein to the labeled AP1 probe, and the fifth lane is the binding band of the SEP3‐T5 mutant protein to the labeled AP1 probe.

FIGURE 8

Phenotypic observation. (A) Phenotype and quantitative statistics of rosette leaves in AtSEP3, AtSEP3‐T5 (Col‐0), and AtSEP3‐T5 (sep3) transgenic plants. (B) Bolting situation of AtSEP3, AtSEP3‐T5 (Col‐0), and AtSEP3‐T5 (sep3) transgenic plants. (C) Statistics analysis of leaf area in AtSEP3, AtSEP3‐T5 (Col‐0), and AtSEP3‐T5 (sep3) transgenic plants.

FIGURE 9

Phenotypes of the first and second whorl floral organs. (A) Petals in Col‐0,AtSEP3, AtSEP3‐T5 (Col‐0), and AtSEP3‐T5 (sep3) transgenic plants. (B) Sepals in Col‐0, AtSEP3, AtSEP3‐T5 (Col‐0), and AtSEP3‐T5 (sep3) transgenic plants.

FIGURE 10

Flower phenotypes of Col‐0, AtSEP3, AtSEP3‐T5 (Col‐0), and AtSEP3‐T5 (sep3) transgenic plants.

FIGURE 11

Diagram of flowering induction pathway in Arabidopsis.