Diversity and Functional Roles of Microorganisms in Anatolian Black Pine Cone Vinegar Fermentation

Abstract

The parts of some pine species are a rich source of bioactive compounds that can be used in various food products. The current work, the physicochemical, bioactive, antimicrobial, sensory, and aromatic properties of traditional vinegar produced from Anatolian Black Pine Cones from different provinces of Turkey were determined, as well as the cultivable microbial diversity and metagenomic analysis. The total phenolic content of the vinegars ranged from 163.88 to 174.79 mg GAE/L. Antioxidant activity, measured via DPPH and ABTS assays, varied among the samples. CnB vinegar, made from Burdur province cones, stood out for its bioactive compounds, including terpenes, acetic acid, ascorbic acid, and the highest α-terpineol content (3.13%). CnB also exhibited the strongest antimicrobial activity, with the largest inhibition zone (44.91 mm) against E. coli type A, while CnM showed the lowest activity. Sensory evaluations favored CnB for its balanced flavor, while CnV was criticized for excessive sharpness, and CnM was deemed too mild. The bacterial microbiome of CnB was predominantly composed of acetic acid bacteria, with an average concentration of 7.36 log CFU/mL in the enumeration of culturable microorganisms. The dominant bacterial taxa at the phyla level included Proteobacteria (72.296%), Firmicutes (22.062%), Bacteroidota (3.665%), followed by Acetobacteraceae (71.47%), Clostridia (13.187%), Bacilli (5.066%), Bacteroidetes (3.665%), and C. negativicutes (3.737%) at the phylum level. The fungal microbiome was mainly represented by Ascomycota (78.717%) and Eukaryota Incertae sedis (15.840%). The findings demonstrate that pine cone vinegar can be employed in a multitude of applications, including food preservation and health promotion.

Keywords: Anatolian black pine cone; antimicrobial activity; bioactive components; microbiota; vinegar.

FIGURE 1

Schematic flowchart depicting the process for production of traditional cone vinegars.

FIGURE 2

Sensory analysis scores of all tested vinegar.

FIGURE 3

Total bacterial (A) and acetobacter (B) composition of microbial communities present in CnB vinegar. *Gene Region primer sequence (F → R): Universal specific reverse and forward primer set for bacteria 16S V3‐V4; 31 F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG; 805 R:GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC.

FIGURE 4

Fungal composition of microbial communities present in CnB vinegar. *Gene Region primer sequence (F → R): Universal specific reverse and forward primer set for mold‐yeast ITS3: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GCATCGATGAAGAACGCAGC; ITS4: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC.