Wo interacts with SlTCP25 to regulate type I trichome branching in tomato

Abstract

Plant trichomes serve as a protective barrier against various stresses. Although the molecular mechanisms governing the initiation of trichomes have been extensively studied, the regulatory pathways underlying the trichome branching in tomato remain elusive. Here, we found that Woolly (Wo) mutant and its overexpression transgenic plants displayed branched type I trichomes. The expression level of SlTCP25, a transcription factor of type TB1 of the TCP subfamily, was obviously decreased in Wo mutant and Wo overexpressing lines. Knockout of SlTCP25 resulted in the formation of type I trichome branches on the hypocotyls. Genetic evidence showed that SlTCP25 is epistatic to Wo in the branched trichome formation. Biochemical data further indicated that Wo can directly bind to the L1-box cis-element in the SlTCP25 promoter and repress its transcription. We further determined that SlTCP25 interacts with Wo to weaken Wo-regulated the expression of SlCycB2, a trichome branching inhibitor. In addition, the number of trichome branches was significantly increased in Sltcp25Slcycb2 double mutant, suggesting that SlTCP25 and SlCycB2 coordinately repress trichome branching in wild type. In conclusion, we elucidate a molecular network governing the morphogenesis of multicellular trichomes in tomato.

Figure 1

Phenotypic characterization of AC, Wo mutant, and Wo overexpression plants. (A) Hypocotyl trichomes of AC and LA3186 plants. Bar, 500 μm. (B) The branch percentage of the type I trichomes on hypocotyl of LA3186. br, branch number per trichome (n = 100). (C) Images of the hypocotyl trichomes of AC and LA3186. The images were obtained by cryo-scanning electron microscopy. The white arrows indicate the branch points. Bar, 500 μm. (D) Hypocotyl trichomes of AC and Wo overexpression lines. Bar, 500 μm. (E) The branch percentage of type I trichomes on the hypocotyl of Wo overexpression lines. br, branch number per trichome (n = 100).

Figure 2

Functional validation of SlTCP25. (A) Expression levels of SlTCP25 in AC, LA3186, Wo-KO, and Wo-OE plants. RNA samples were taken from hypocotyl trichomes. Data are means ± SD (n = 3). The p-values were determined using the Student’s t-test (^*, P < .05; ^**, P < .01). (B) Subcellular localization of SlTCP25 in N. benthamiana leaf epidermal cells. YFP indicates empty vector with a yellow fluorescent protein tag. GFP, green fluorescent protein; mCherry, NLS-RFP fusion protein with red fluorescent; BF, bright field. The images were captured using a laser confocal microscope. Bar, 25 μm. (C) Gene editing results of three Sltcp25 lines. The letters with underline represent the PAM sites. The inserted (+) and deleted (−) bases are presented on the right side of each target site. (D) Trichomes of AC and the Sltcp25 lines. The samples were collected from three-week-old hypocotyls of AC and the Sltcp25 lines. Bar, 500 μm. (E) Images of the hypocotyl trichomes of AC and the Sltcp25 plants from cryo-SEM. Bar, 500 μm. (F) and (G) The branch percentage of the type I trichomes (F) and type V trichomes (G) on the hypocotyl of the Sltcp25 lines. br, branch number per trichome (n = 70 in F, n = 20 in G).

Figure 3

Wo inhibits the expression of SlTCP25. (A) Schematic diagram of the 3 kb promoter sequence of SlTCP25. The underline indicates the L1-box cis-element location in the promoter of SlTCP25. (B) Wo binds to the SlTCP25 promoter, as shown by Y1H assay. Co-expression of empty AD with the SlTCP25 promoter was used as a negative control. Yeast cells were grown and selected on SD-Leu medium containing 30 ng/ml aureobasidin A (AbA). (C) Schematic diagram of Wo effector construct and LUC gene reporter construct. (D) Dual luciferase assay showing the effect of Wo on the activity of the SlTCP25 promoter in N. benthamiana leaves, as confirmed by co-expression of empty pGreen II 62-SK (Empty) or 62SK-Wo (Wo) and proSlTCP25: LUC. LUC, firefly luciferase activity; REN, Renilla reniformis luciferase activity. Data are means ± SD (n = 3). Asterisks indicate significant differences according to the Student’s t-test analysis (^**, P < .01). (E) and (F) Analysis of β-glucuronidase (GUS) activity after co-expression Wo effector protein and the SlTCP25 promoter. Transient expression of GUS gene driven by the SlTCP25 promoter in N. benthamiana leaves (E) was utilized for quantitative analysis of GUS expression (F). Data are means ± SD (n = 3). The empty vector driven by 35S was used as a negative control. The p-values were determined using the Student’s t-test (^**, P < .01). (G) EMSA assay showed that Wo binds to L1-box element in the promoter of SlTCP25. The black bands below represent the probes, and the bands above indicate the mixture of target protein and the probes. The SlTCP25-L1-probe (CATAAAAGGTATGGTAAATGCTATCAGTATATAT) and mutated probe (CATAAAAGGTATGGTTTTTTTTATCAGTATATAT) were used for the assay. Probes are labeled with 5’ FAM.

Figure 4

Genetic interaction of Wo and SlTCP25 during trichome branch formation. (A) Trichome phenotype of AC, wo mutant, Sltcp25 mutant, and the wo Sltcp25 double mutant. The representative images are presented from three-week-old hypocotyls. Bar, 500 μm. (B) The average branch number of the type I trichomes on hypocotyl of the genotypes in (A). Data are means ± SD (n = 10). Statistically significant differences were determined using Student’s t-test.

Figure 5

SlTCP25 interacts with Wo. (A) Schematic diagram of the truncated SlTCP25 amino acid sequence. SlTCP25–1, N-terminal; SlTCP25–2, N-terminal containing TCP domain; SlTCP25–3, single TCP domain; SlTCP25–4, C-terminal; SlTCP25–5, C-terminal containing TCP domain. (B) Self-activation assay of SlTCP25 in yeast. The truncated SlTCP25 fragments were cloned into the pGBKT7 vector, respectively, and the resulting recombinant plasmids were separately transformed with empty pGADT7 into yeast strain AH109. The yeast cells were cultured on SD-Leu-Trp (SD-L-T) and selected on SD-Leu-Trp-His-Ade (SD-L-T-H-A) deficient media. Positive, BD-p53 + AD-T; Negative, BD-lam + AD-T. (C) Y2H assay showing the interaction between Wo and SlTCP25. Positive, BD-p53 + AD-T; Negative, BD-lam + AD-T and BD-SlTCP25–2 + AD. Three biological replicates were performed in each group. (D) BiFC assay analysis of the interaction between Wo and SlTCP25. The fluorescence signal indicates that Wo interacts with SlTCP25. SlTCP25-NE and CE combinations were used as a negative control. Bar, 25 μm. (E) LCI assay showing the protein interaction between Wo and SlTCP25. The combinations represented by different numbers are as follows: (1) Wo-nLUC+SlTCP25-cLUC; (2) Wo-nLUC+cLUC; (3) nLUC+SlTCP25-cLUC; (4) nLUC+cLUC. Compared to the other control groups, the fluorescence signals indicate the interaction between Wo and SlTCP25.

Figure 6

The interaction of SlTCP22 and SlTCP25. (A) and (B) Trichome phenotype of AC, Sltcp22 mutant, Sltcp25 mutant, and the Sltcp22 Sltcp25 double mutant. Bar, 5 mm in A, 500 μm in B. (C) The average branch number of the type I trichomes on hypocotyl of the AC, Sltcp22, Sltcp25, and the Sltcp22 Sltcp25 double mutant. Data are means ± SD (n = 20). Statistically significant differences were determined using one-way ANOVA. (D) Y2H assay showing the interaction of SlTCP25 and SlTCP22 in yeast. Positive, BD-p53 + AD-T; Negative, BD-lam + AD-T and empty BD. (E) Analysis of the interaction between SlTCP22 and SlTCP25 in LCI assay. The combinations represented by different numbers are as follows: (1) SlTCP25-nLUC+SlTCP22-cLUC; (2) SlTCP25-nLUC+cLUC; (3) nLUC+SlTCP22-cLUC; (4) nLUC+cLUC. (F) Interaction of SlTCP25 and SlTCP22 in N. benthamiana leaf cells, as validated by co-immunoprecipitation assay. The total proteins and immunoprecipitated proteins with anti-FLAG agarose beads were detected by western blotting using anti-GFP antibody and anti-FLAG antibody, respectively. GFP-MYC protein driven by 35S promoter was used as a negative control.

Figure 7

The molecular and genetic relationship of SlTCP25 and SlCycB2. (A) SlTCP25 do not interact with SlCycB2 in yeast, as shown by Y2H assay. Positive, BD-p53 + AD-T; Negative, BD-lam + AD-T and empty BD + AD-SITCP25. (B) LCI assay showing the influence of SlCycB2 on the interaction between Wo and SlTCP25. GFP-MYC was used as a negative control. (C) Trichome phenotype of AC, Slcycb2 mutant, Sltcp25 mutant, and the Sltcp25 Slcycb2 double mutant. Bar, 500 μm. (D) The average branch number of the type I trichomes on hypocotyl of the indicated lines in (C). Data are means ± SD (n = 10). Significance differences were determined using one-way ANOVA.