Prolactin Mediates Distinct Time Course Regulation of Tyrosine Hydroxylase Phosphorylation and Gene Expression in Tuberoinfundibular Dopaminergic Neurons of Female Rats

Abstract

Prolactin (PRL) regulates its own secretion by short-loop feedback to tuberoinfundibular dopaminergic (TIDA) neurons. PRL-induced cellular mechanisms in the regulation of tyrosine hydroxylase (TH) are not completely understood. The objectives were to (1) examine PRL-induced, time-dependent hypothalamic changes in JAK2-STAT5B signaling, TH activity, TH phosphorylation state and Th mRNA levels, and (2) evaluate direct influences of PRLR-STAT5B signaling on Th promoter activity. Ovariectomized rats were administered ovine PRL. JAK2 and STAT5 phosphorylation in the mediobasal hypothalamus peaked at 15 and 30-60 min, respectively. TH Ser40 phosphorylation in the median eminence was increased between 2 and 72 h, correlating with increased dihydroxyphenylalanine (DOPA) accumulation. Th mRNA levels in TIDA neurons were unchanged up to 72 h but elevated by 7 days. PRL did not alter Th promoter activity in CAD cells, and STAT5B did not bind three putative Gamma Interferon Activation Sites (GAS) elements. We conclude that PRL initiates an integrated cascade of cellular mechanisms in TIDA neurons, including JAK2-STAT5B activation, TH Ser40 phosphorylation coupled to increased TH activity, followed by a delayed rise in Th gene expression. PRL-induced changes in Th gene expression are not the result of STAT5-mediated transactivation but likely result from enduring changes in TIDA neuronal activity.

Keywords: JAK2; STAT5; TIDA; dopamine; gene expression; phosphorylation; prolactin; prolactin receptor signaling; promoter activity; tyrosine hydroxylase.

Figure 6

Time course for Th gene expression in the MBH in bromocriptine (BROMO)-treated rats with or without oPRL infusion. Endogenous serum rPRL levels (A) and Th gene expression as determined by qRT-PCR (B) in ovariectomized female rats after 3 days of bromocriptine (3 mg/kg, s.c.) or 20% ethanol vehicle control (CONT; 0.5 mL/kg rat weight, s.c.) treatment at 12 h intervals. Each value is a mean ± SE of determinations from 8 rats. White bars are samples from vehicle-treated (CONT) rats and stippled bars are samples from bromocriptine-treated (BROMO) rats. * Significantly different (p < 0.05) from the vehicle-treated control (CONT) group. (C,D) TH gene expression, as determined by qRT-PCR, in bromocriptine-treated ovariectomized female rats infused with oPRL (200 µg/mL) at a rate of 120 µL/h for up to 4 h (C) or infused with oPRL (10 mg/mL) at a rate of 1 µL/h using an Alzet osmotic minipump for 1 to 7 days (D). Each value is a mean ± SE of determinations from 8 rats. Stippled bars are samples from bromocriptine and vehicle-treated rats and black bars are samples from bromocriptine and oPRL-treated rats as indicated in Figure 1C. * Significantly different (p < 0.05) from the control (0 h) group.

Figure 1

Experimental design timelines for procedures, hormone treatment and sample collection. (A) The timeline for experiments examining the JAK2 and STAT5 phosphorylation state in the MBH. The top arrows represent sample collection times for JAK2 phosphorylation studies, and the bottom arrows represent sample collection times for STAT5 phosphorylation. Black arrows indicate procedures, red arrows indicate sample collection for the oPRL-treated group, and blue arrows indicate sample collection for the vehicle-treated group (0 h with respect to oPRL treatment). (B) Experimental design timeline for circulating oPRL, circulating rPRL, TH activity in the ME, Th mRNA levels in the arcuate nucleus, and TH phosphorylation state in the ME after vehicle or oPRL treatment. The top bar and arrows represent treatment and sample collection times, respectively, for infusion studies of ≤12 h. The bottom bar and arrows represent treatment and sample collection times, respectively, for infusion studies of >12 h. Black arrows indicate procedures, red arrows indicate sample collection for the oPRL-treated group, and blue arrows indicate sample collection for the vehicle-treated group (0 h with respect to oPRL treatment). (C) The timeline for Th mRNA levels in the arcuate nucleus after oPRL treatment in vehicle or bromocriptine (BROMO) pre-treated rats. The top bar and arrows represent treatment and sample collection times, respectively, for infusion studies of ≤12 h. The bottom bar and arrows represent treatment and sample collection times, respectively, for infusion studies of >12 h. Green bars represent 3 days of treatment with bromocriptine (BROMO) or vehicle with injections at 12 h intervals. Black arrows indicate procedures, red arrows indicate sample collection for the oPRL-treated group, blue arrows indicate sample collection for the vehicle-treated group (0 h with respect to oPRL treatment), and green arrows indicate sample collection for vehicle and bromocriptine (BROMO) treated groups.

Figure 2

Time course for PRLR activation of JAK2/STAT5 pathway in the mediobasal hypothalamus (MBH) of ovariectomized female rats injected with oPRL (100 µg/rat, i.v.). MBH lysates were used for western blot analysis. (A) Top panel: Representative western blot of pJAK2 and JAK2 protein signals. Bottom panel: pJAK2 band density signal normalized to JAK2 band density signal and expressed as percent control. Each value is a mean ± SE of determinations from 6 rats. (B) Top panel: Representative western blot of JAK2 and β-tubulin protein signals. Bottom panel: Total JAK2 protein band density signal normalized to β-tubulin band density signal and expressed as percent control. Each value is a mean ± SE of determinations from 6 rats. (C) Top panel: Representative western blot of pSTAT5 and STAT5 protein signals. Bottom panel: pSTAT5 band density signal normalized to STAT5 band density signal and expressed as percent control. Each value is a mean ± SE of determinations from 8 rats. (D) Top panel: Representative western blot of STAT5 and β-tubulin. Bottom panel: Total STAT5 protein band density signal normalized to β-tubulin band density signal and expressed as percent control. Each value is a mean ± SE of determinations from 8 rats. (A–D) Stippled bars are samples from rats infused with vehicle and black bars are samples from oPRL-treated rats, as indicated in Figure 1A. (E) A representative western blot of MBH lysates was first immunoprecipitated with selective STAT5A (Top panel) or STAT5B (Bottom panel) antibodies and then blotted with pSTAT5 and pan-STAT5 antibodies. MBH tissues were collected at 45 min after oPRL or vehicle injection. (F) Representative western blots of MBH input lysates from above are blotted with the indicated antibodies. * Significantly different (p < 0.05) from the control group.

Figure 3

Effects of PRL-STAT5B signaling on rat Th promoter constructs. (A) Schematic of rat Th promoter used in luciferase assays. Numbers indicate the size of constructs, and arrows indicate the location of potential STAT5 binding sequences or gamma interferon-activated sites (GAS). An open arrowhead indicates a NRBE binding site for nuclear receptor-related 1 (NURR1) protein, which was used as a positive control for Th promoter activity. (B) CAD cells were co-transfected with the indicated Th promoter-luciferase or casein promoter-luciferase constructs as indicated and with pDNA3, CMV-rPRLR, CMV-rSTAT5B, or rNURR1 constructs as indicated. Cells were also co-transfected with CMV-renilla luciferase to determine transfection efficiency. Cells were treated with vehicle or oPRL (1000 ng/mL) for 24 h, followed by dual luciferase assays. Luciferase values were normalized to the pcDNA3+ vehicle values to determine fold activation. A −0.5 kb casein promoter fragment containing a GAS element was used as a control for PRL-driven promoter activation. Each value is a mean ± SE of 3 independent luciferase assays. (C) PRL-mediated STAT5B signaling in CAD cells. CAD cells were transfected with rPRLR and rSTAT5B and then treated with vehicle or oPRL (1000 ng/mL) for 1 h. Top panel: Cell lysates of the vehicle and oPRL-treated cells were used in western blot analysis with the indicated antibodies. Bottom panel: Immunofluorescence was used to detect the cellular localization of pSTAT5 (green) and pSTAT5 (red) in vehicle and oPRL-treated cells. DNA stain (blue) indicates cell nucleus.

Figure 4

Electrophoretic Mobility Shift Assay (EMSA) analysis of STAT5B binding to putative gamma interferon activation site (GAS) elements in the Th promoter. (A) FLAG-STAT5B and constitutively active FLAG-STAT5B (CA) were purified from transfected HEK 293t cells. Purified proteins were separated on SDS-PAGE gels and stained with Coomassie Blue to detect proteins (top panel) or used in western blot analysis for Stat5 and pSTAT5 proteins (bottom panels) to confirm the purity of isolated protein and increased phosphorylation of FLAG-STAT5B (CA) compared to wildtype unphosphorylated FLAG-STAT5B. (B) EMSA analysis using FLAG-STAT5B (CA) protein and the indicated dsDNA probes for GAS sites for the control casein (CON) promoter (TGGACTTCTTGGAATTAAGGGT), Cish promoter, GAS1 site of the rat Th promoter at −1061 bp and the Th GAS1 site when the internal sites of the GAS1 site were mutated to those of the casein GAS site (GAS1int2). Note that the band indicates binding to CON, Cish, and GAS1int2 sequences but not the Th GAS1 site at −1061 bp. Sequences for the dsDNA probes are listed in the bottom panel. (C) EMSA analysis using wildtype unphosphorylated FLAG-STAT5B or FLAG-STAT5B (CA) and dsDNA probes for the −1061 bp (top right panel), −2751 bp (bottom left panel), and the −5121 bp (bottom right panel) putative GAS elements of the Th promoter. A control casein (CON) promoter sequence was used on the top left panel.

Figure 5

Time course of circulating endogenous rPRL levels, TH catalytic activity in the ME, and Th gene expression in the arcuate nucleus after the initiation of oPRL infusion. Serum oPRL levels (A) and endogenous serum rPRL levels (B) at indicated times after initiating oPRL infusion. oPRL (200 µg/mL) was infused at a rate of 120 µL/h for up to 12 h, and oPRL (10 mg/mL) was infused at a rate of 1 µL/h using an Alzet osmotic minipump for the 24 h and 72 h groups. Each value is a mean ± SE of determinations from 14 to 16 rats for the 0.25 h to 72 h group and 37 rats for the control (0 h) group. Note that PRL levels were determined from rats used for TH phosphorylation, and two control samples were included on each blot (Figure 6). (C) TH catalytic activity as assessed by dihydroxyphenylalanine (DOPA) accumulation in the ME at 15 min after injection of m-hydroxybenzylhydrazine dihydrochloride (NSD1015; 25 mg/kg i.v.). Each value is a mean ± SE of determinations from 9 to 10 rats. (D) Th gene expression as assessed by Th mRNA signal levels in the arcuate nucleus using the in situ hybridization technique. Each value is a mean ± SE of determinations from 5 to 7 rats. Stippled bars are samples from rats infused with vehicle and black bars are samples from oPRL-treated rats, as indicated in Figure 1B. * Significantly different (p < 0.05) from the control (0 h) group.

Figure 7

Time course for phosphorylation state of TH protein in the ME of ovariectomized female rats infused with oPRL (200 µg/h, i.v.) for the indicated time. ME lysates were used for western blot analysis of pSer40 (A), pSer31 (B), and pSer19 (C) in the regulatory domain of TH and total TH protein (D). (A–C) Top panels: Representative western blots of pTH at indicated serine residues and TH protein signals. Bottom panels: pTH band density signals at the indicated serine residue normalized to the respective TH band density signal on the same blot and expressed as percent control. (D) Top panel: Representative western blot of TH and β-tubulin protein signals. Bottom panel: Total TH protein band density signal normalized to β-tubulin band density signal and expressed as percent control. Each value is a mean ± SE of determinations from 7 to 15 rats for 0.25 h to 72 h and 37 to 39 rats for 0 h control samples. Note: two control samples were included on each blot and averaged before normalizing pTH values to the average 0 h control value for each blot. Given the limited number of lanes, not all time groups were included on the same blots, but all pTH or TH values were normalized to the average of two 0 h control values on the same blot. Stippled bars are samples from rats infused with vehicle and black bars are samples from oPRL-treated rats, as indicated in Figure 1B. * Significantly different (p < 0.05) from the control (0 h) group.