miR-216 Is a Key Regulator and Potential Marker in Human Cancers

Abstract

MicroRNAs, a class of small noncoding RNAs, have been identified as promising biomarkers for cancer identification and management by regulating gene expression and other cellular biological pathways. This review gathers findings for understanding the molecular basis and clinical importance of microRNA-216 (miR-216) in several cancers. Increased or decreased expression of miR-216 has been observed in a variety of cancers, including esophageal cancer, breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, cervical cancer, brain tumor (glioma), prostate cancer, and acute myeloid leukemia, indicating its activity as an oncogene or tumor suppressor. Through this study, we proposed that miR-216 can potentially be a candidate as a prognostic marker for early detection of tumor development, progression, as well as metastasis in cancer patients.

Keywords: Biomarker; cancer; miR-216; microRNA; microRNA-216.

Figure 1

Prediction of Optimal Secondary structure of the has-miR-216 (EPS format) with −40.30 kcal/mol with its dot-bracket notation using the Rfold webserver. The sequence of this microRNA: TAATCTCAGCTGGCAACTGTG