Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Review
. 2025 May 31:14:40.
doi: 10.4103/abr.abr_184_23. eCollection 2025.

miR-216 Is a Key Regulator and Potential Marker in Human Cancers

Affiliations
Review

miR-216 Is a Key Regulator and Potential Marker in Human Cancers

Mozhgan Mondeali et al. Adv Biomed Res. .

Abstract

MicroRNAs, a class of small noncoding RNAs, have been identified as promising biomarkers for cancer identification and management by regulating gene expression and other cellular biological pathways. This review gathers findings for understanding the molecular basis and clinical importance of microRNA-216 (miR-216) in several cancers. Increased or decreased expression of miR-216 has been observed in a variety of cancers, including esophageal cancer, breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, cervical cancer, brain tumor (glioma), prostate cancer, and acute myeloid leukemia, indicating its activity as an oncogene or tumor suppressor. Through this study, we proposed that miR-216 can potentially be a candidate as a prognostic marker for early detection of tumor development, progression, as well as metastasis in cancer patients.

Keywords: Biomarker; cancer; miR-216; microRNA; microRNA-216.

PubMed Disclaimer

Conflict of interest statement

There are no conflicts of interest.

Figures

Figure 1
Figure 1
Prediction of Optimal Secondary structure of the has-miR-216 (EPS format) with −40.30 kcal/mol with its dot-bracket notation using the Rfold webserver. The sequence of this microRNA: TAATCTCAGCTGGCAACTGTG

References

    1. Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, et al. Landscape of transcription in human cells. Nature. 2012;489:101–8. - PMC - PubMed
    1. Kambara H, Niazi F, Kostadinova L, Moonka DK, Siegel CT, Post AB, et al. Negative regulation of the interferon response by an interferon-induced long non-coding RNA. Nucl Acids Res. 2014;42:10668–80. - PMC - PubMed
    1. Lee JT. Epigenetic regulation by long noncoding RNAs. Science. 2012;338:1435–9. - PubMed
    1. Rafat M, Moraghebi M, Afsa M, Malekzadeh K. The outstanding role of miR-132-3p in carcinogenesis of solid tumors. Hum Cell. 2021;34:1051–65. - PubMed
    1. Yadegar N, Dadashi Z, Shams K, Mohammadi M, Abyar M, Rafat M. The prominent role of miR-942 in carcinogenesis of tumors. Adv Biomed Res. 2022;11:63. - PMC - PubMed

LinkOut - more resources