Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides
- PMID: 4059050
- PMCID: PMC321970
- DOI: 10.1093/nar/13.18.6447
Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides
Abstract
Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.
Similar articles
-
Application of 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite for in situ preparation of deoxyribonucleoside phosphoramidites and their use in polymer-supported synthesis of oligodeoxyribonucleotides.Nucleic Acids Res. 1986 Sep 25;14(18):7391-403. doi: 10.1093/nar/14.18.7391. Nucleic Acids Res. 1986. PMID: 3763407 Free PMC article.
-
Prevention of guanine modification and chain cleavage during the solid phase synthesis of oligonucleotides using phosphoramidite derivatives.Nucleic Acids Res. 1986 Aug 26;14(16):6453-70. doi: 10.1093/nar/14.16.6453. Nucleic Acids Res. 1986. PMID: 3748816 Free PMC article.
-
Guanine modification during chemical DNA synthesis.Nucleic Acids Res. 1987 Oct 26;15(20):8333-49. doi: 10.1093/nar/15.20.8333. Nucleic Acids Res. 1987. PMID: 3671086 Free PMC article.
-
Modifications of guanine bases during oligonucleotide synthesis.Nucleic Acids Res. 1988 May 25;16(10):4539-54. doi: 10.1093/nar/16.10.4539. Nucleic Acids Res. 1988. PMID: 3380687 Free PMC article.
-
DNA/RNA synthesis and labelling.Curr Opin Biotechnol. 1991 Feb;2(1):61-8. doi: 10.1016/0958-1669(91)90062-a. Curr Opin Biotechnol. 1991. PMID: 1370064 Review.
Cited by
-
Solid-phase synthesis of branched oligoribonucleotides related to messenger RNA splicing intermediates.Nucleic Acids Res. 1992 Dec 25;20(24):6565-73. doi: 10.1093/nar/20.24.6565. Nucleic Acids Res. 1992. PMID: 1480476 Free PMC article.
-
Synthesis of DNA via deoxynucleoside H-phosphonate intermediates.Nucleic Acids Res. 1986 Jul 11;14(13):5399-407. doi: 10.1093/nar/14.13.5399. Nucleic Acids Res. 1986. PMID: 3737406 Free PMC article.
-
Studies on the role of tetrazole in the activation of phosphoramidites.Nucleic Acids Res. 1989 Feb 11;17(3):853-64. doi: 10.1093/nar/17.3.853. Nucleic Acids Res. 1989. PMID: 2922273 Free PMC article.
-
Application of 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite for in situ preparation of deoxyribonucleoside phosphoramidites and their use in polymer-supported synthesis of oligodeoxyribonucleotides.Nucleic Acids Res. 1986 Sep 25;14(18):7391-403. doi: 10.1093/nar/14.18.7391. Nucleic Acids Res. 1986. PMID: 3763407 Free PMC article.
-
Novel Organophosphate Ligand O-(2-Fluoroethyl)-O-(p-Nitrophenyl)Methylphosphonate: Synthesis, Hydrolytic Stability and Analysis of the Inhibition and Reactivation of Cholinesterases.Chem Res Toxicol. 2016 Nov 21;29(11):1810-1817. doi: 10.1021/acs.chemrestox.6b00160. Epub 2016 Oct 17. Chem Res Toxicol. 2016. PMID: 27551891 Free PMC article.
References
Publication types
MeSH terms
Substances
LinkOut - more resources
Full Text Sources
Other Literature Sources