De Novo Missense Variant c.170 C > A of ELANE in a Chinese Infant with Congenital Neutropenia: Case Report and Literature Review

Abstract

Congenital neutropenia (CN) is a rare hereditary blood disorder characterized by a significant reduction in neutrophils, making patients prone to recurrent and severe infections and even a risk of developing myelodysplastic syndrome or acute leukemia, often caused by the ELANE variants, and the complex relationship between ELANE variants and clinical phenotypes, as well as the natural course of the disease, remains unclear. We describe a case of CN in a Chinese infant caused by the De Novo missense variant c.170 C > A in the ELANE gene, presented with persistent neutropenia since the neonatal period, accompanied by recurrent infections. He did not receive G-CSF treatment due to the declination of his parents, but antibiotics were administered during infections or with high hsCRP levels. During the early neonatal stage, the patient consistently exhibited severe neutropenia (ANC < 0.5 × 10^9/L). Periodic fluctuations in neutrophil counts observed twice a week during particular months suggest a cyclical pattern. Until now, he still experiences varying degrees of neutropenia persistently, with ANC occasionally exceeding 1.0 × 10^9/L during infections. Multiple prediction scoring tools and models support the pathogenicity of this missense variant. This case highlights a rare pathogenic variant of ELANE, which, to our knowledge, is the first case of the variant c.170 C > A (p.Ala57Asp) of the intermediate phenotype of CN in mainland China and a rare variant globally, indicating phenotypic variability in ELANE-related neutropenia due to an Ala57 mutation. The clinical management of CN caused by ELANE variants poses a challenge for clinicians and deserves attention. Timely diagnosis, treatment, and extended follow-up are of paramount value.

Keywords: ELANE Variant; Case Report; Congenital Neutropenia; Pathogenic Variant; Primary Immunodeficiencies; Recurrent Infections; Severe Infections.

Fig. 1

Characteristics of absolute neutrophil count and mouth ulcers. (A) The picture shows the trend of absolute neutrophil and monocyte count. Multiple blood count tests indicated severe neutropenia over three times within three months in the early age (absolute neutrophil count＜0.05×10^9/L). The patient consistently exhibited various degrees of neutropenia (ANC < 1.5×10^9/L). Peripheral monocyte count increased over 1.0×10^9/L most times. In July and August 2022, October and November 2023, and January, February, and March 2024, the serial blood counts twice a week occasionally showed a clear cyclic pattern of neutrophil count fluctuations while there were non-cyclical counts at other times. Also, he had recurrent mild anemia and an increased peripheral monocyte count. (B-C) The pictures display a mouth ulcer on the labial mucosa (lining of the lower lip) of the patient in January 2024

Fig. 2

The Genetic analysis. (A) shows the confirmatory Sanger sequencing analysis of ELANE. Forward and reverse strand sequencing were both used for the analysis. The primers used for sequencing were CGGAGGCCACTTCTGCGGCGCCACCCTGATTGCGCCCAACT (forward) and AGTTGGGCGCAATCAGGGTGGCGCCGCAGAAGTGGCCTCCG (reverse). (B) and (C) were available on SWISS-MODEL, and (B) displays the normal protein of ELANE while (C) displays De Novo missense variant c.170C>A. According to protein structure prediction, c.170C>A will result in the replacement of alanine (Ala) with aspartic acid (Asp) at the Ala57 residue. The carboxyl terminus (C terminus) of Asp affects the spatial structure and biological function of proteins and peptides. (D) and (E) were available on Mol* 3D Viewer of RCSB PDB. Ala is a non-polar aliphatic amino acid with hydrophobicity, while Asp is an acidic amino acid with hydrophilicity. Asp increases the hydrogen bond binding of adjacent amino acids, marked as a red arrow in (E).