Protocol for CRISPR-based manipulation and visualization of endogenous α-synuclein in cultured mouse hippocampal neurons

Abstract

CRISPR-Cas9 technology enables acute gene knockdown and endogenous tagging to study single-synapse function. Here, we present a protocol for depleting alpha-synuclein (α-syn) or visualizing native α-syn with an endogenously inserted fluorescent tag in cultured mouse hippocampal neurons. We describe detailed steps, including CRISPR design, virus packaging/transduction (delivery), and validation of on-/off-target editing. This protocol should be useful for assigning precise function to contentious synaptic proteins and for visualizing protein trafficking without overexpression in cultured hippocampal neurons-an established model system for synaptic biology. For complete details on the use and execution of this protocol, please refer to Parra-Rivas et al.¹.

Keywords: CRISPR; Cell Biology; Cell culture; Microscopy; Molecular Biology; Neuroscience.

Graphical abstract

Figure 1

Selection of sgRNA target sites for CRISPR KI design To identify optimal sgRNA target sites, the gene of interest (e.g., Snca) was searched using the NCBI PubMed Nucleotide database (https://www.ncbi.nlm.nih.gov/nucleotide).

Figure 2

Strategy for sgRNA design targeting the last exon of a gene To design CRISPR KI sgRNAs, GenBank files for each transcript variant were downloaded and aligned to identify the final exon. A representative sequence from the last exon of Snca (highlighted) was used as the template for sgRNA selection.

Figure 3

sgRNA design using CRISPOR To identify candidate sgRNAs for CRISPR KI, the target DNA sequence from the final exon was entered into the CRISPOR web tool (https://crispor.gi.ucsc.edu/), and the appropriate reference genome was selected. CRISPOR provides a ranked list of sgRNAs based on predicted efficiency and off-target scores.

Figure 4

Identification of candidate sgRNA sequences Following CRISPOR analysis, sgRNA candidates were ranked based on predicted on-target efficiency, specificity scores, and potential off-target effects. Ideal sgRNAs are located as close as possible to the intended KI site, within the final exon, and exhibit high specificity with minimal off-target risk. Sequences with high MIT specificity and CFD scores were prioritized for further testing.

Figure 5

Schematic of CRISPR KI vector design and key elements hU6: Human U6 promoter, amplified from the pMJ117 plasmid (Addgene plasmid #85997; a gift from Jonathan Weissman), drives robust expression of the single guide RNA (sgRNA) in mammalian cells. gRNA Insertion Site: Site cleaved by the BbsI restriction enzyme to allow insertion of the sgRNA sequence of interest. Scaffold cr1: Codon-optimized sgRNA scaffold sequence, amplified from the pMJ114 plasmid (Addgene plasmid #85995; a gift from Jonathan Weissman), forms the structural component of the sgRNA and facilitates Cas9 binding. mU6: Mouse U6 promoter, amplified from the pMJ179 plasmid (Addgene plasmid #85996; a gift from Jonathan Weissman), drives expression of a second sgRNA cassette. gRNA (DRSR2): sgRNA sequence targeting the donor recognition sequence R2 (DRSR2): 5′-GCGATCGTAATCACCCGAGT-3′,used for homology-independent targeted integration.Scaffold cr2: Codon-optimized sgRNA scaffold sequence, amplified from the pMJ179 plasmid (Addgene plasmid #85996; a gift from Jonathan Weissman, used in conjunction with the DRSR2-targeting gRNA to support Cas9 function. DRSR2: Target site recognized by the gRNA: DRSR2, 5′-GCGATCGTAATCACCCGAGTGGG-3′ to enable targeted cleavage and integration of the KI cassette. Linker: Flexible amino acid linker (N-GGGGSGGGGSGGGGS-C) inserted between the targeted protein and oScarlet to minimize steric hindrance and preserve protein function. Sequence Between the Linker and oScarlet: Distinct sequences were inserted between the linker and oScarlet to preserve the correct reading frame in each construct. The sequences are as follows: ORF-0, 5′-CCTCGA-3’; ORF-1, 5′-CTCGA-3’; ORF-2, 5′-CGCTCGA-3’.oScarlet: Codon-optimized red fluorescent protein (RFP) used as a KI tag, It enables visualization of the tagged endogenous protein in live or fixed cells, amplified from the pAAV-Ef1a-oScarlet plasmid (Addgene plasmid #137135; gift from Karl Deisseroth). X: Sequence containing multiple stop codons in all three reading frames to ensure translational termination where appropriate.

Figure 6

ORF at the Cas9 cleavage site for in-frame Snca CRISPR KI design An example of ORF +2 cleavage can be seen in the Snca gene, where the cut occurs within the codon for the amino acid 'D,' separating the sequence 'ga' from 'c.'.

Figure 7

Global and selective attenuation of α-syn in hippocampal cultures using CRISPR-Cas9 (A) Cultured neurons were transduced with lentiviruses (13,013 bp) or AAVs (7289 bp) carrying CRISPR-components (α-syn KO gRNA and Sp/SaCas9) to knockdown mouse α-syn, followed by western blots and immunostaining. A gRNA not targeting to any known sequence in the mouse genome [“Scramble (Scr) Control”] was used as controls. (B) Endogenous mouse α-syn was almost undetectable in lentiviral-transduced cultures using western blots, and the attenuation was selective for α-syn (gel and quantification on the right; ∗∗∗, p < 0.001 by Student’s t test; n = 3). (C) Representative images show marked attenuation of synaptic α-syn immunostaining in lentiviral-transduced α-syn KO-gRNA/SpCas9 treated neurons, with widespread (∼100%) transduction of SpCas9. (D) On target TIDE analysis of DNA from mouse hippocampal neurons treated with lentiviral-transduced α-syn KO/Cas9-gRNA (n = 2 samples). Note on-target deletions and insertions seen only with α-syn-gRNA/SpCas9. (E) Western blots from cultured neurons transduced with a single AAV carrying α-syn KO-gRNA and SaCas9 show marked attenuation of α-syn levels, quantified on the right (∗∗∗, p < 0.001 by Student’s t-test; n = 3).

Figure 8

Endogenous tagging of α-syn in cultured neurons using CRISPR-Cas9 (A) KI strategy to insert a fluorescent tag oScarlet at the C-terminus of endogenous mouse α-syn. Note that two AAVs are used – the AAV α-syn:oScarlet KI donor and AAV-SpCas9. CRISPR KI targeting of the Snca1 exon 6 locus was achieved using a sgRNA sequence (5′-AGGCTTCAGGCTCATAGTCT-3′) cloned into an AAV KI donor vector containing the oScarlet tag. Hippocampal neurons were transduced with the AAV, and genomic DNA was extracted at DIV 21. (B) PCR analysis was performed to validate the integration at the 5′ and 3′ junctions. For the 5′ junction, amplification was conducted using the α-syn forward primer (PCR#1): 5′ TGTGCTTTCTCTTCCCTCTCTG 3′ and oScarlet reverse primer: 5′ ACAGGATGTCCCAGGAGAAG 3’. For the 3′ junction, the α-syn forward primer (PCR#2): 5′ ATAACACTTCGTGCAGCACC 3′ and the same oScarlet reverse primer were used. Amplified products of approximately 500 bp confirm successful KI integration at both junctions. (C) Samples from CRISPR KI tagging (neuronal protein lysates) were analyzed by NuPAGE and immunoblotted with antibodies against α-syn, β-syn (CRISPR KI specificity control), VAMP2/Synapsin I (α-syn interacting proteins) and GAPDH as loading control. Note higher molecular-weight band corresponding to oScarlet-tagged α-syn. (D) Western blotting quantification for gels in (C); ∗∗, p < 0.001 by Student’s t test (n = 3). (E) Strategy for evaluating oScarlet-KI. The AAV α-syn:oScarlet KI donor only, or AAV SpCas9 only were used as controls. AAV transduced neurons were stained with vGlut1 (green) to identify synapses. (F) Representative images of cultured neurons expressing the KI construct (α-syn-KI donor/SpCas9), or controls. Note that neurons co-transduced with AAV α-syn:oScarlet KI donor/AAV SpCas9 show a punctate staining pattern that overlaps with a subset of synapses (top panels). However, no synaptic staining was seen with either the AAV α-syn:oScarlet KI donor only, or AAV SpCas9 alone. (G) Comparison of synaptic fluorescence intensity across all conditions. Notably, α-syn was endogenously tagged with oScarlet in approximately 53% of synapses (top). Minimal synaptic fluorescence was observed in control conditions using either the AAV α-syn:oScarlet KI donor alone or AAV SpCas9 alone (∗∗∗, p < 0.001 by Student’s t-test; AAV α-syn:oScarlet KI donor + AAV SpCas9: n = 106 synapses; AAV α-syn:oScarlet KI donor only: n = 68; AAV SpCas9 only: n = 6).