Bacterial Amyloids as Hubs for Nucleic Acid Interactions: Implications and Mechanisms

Abstract

Amyloids are protein aggregates having a cross-β structure, and they reveal some unusual properties, like interactions with specific dyes and resistance to actions of detergents and proteases, as well as the capability to force some proteins to change their conformation from a soluble form to aggregates. The occurrence of amyloids is not restricted to humans and animals, as they also exist in microbial cells. However, contrary to animals, where amyloids are usually pathological molecules, bacterial amyloids are often functional, participating in various physiological processes. In this review, we focus on a specific property of bacterial amyloids, namely their ability to interact with nucleic acids and resultant regulatory mechanisms. Moreover, some of these interactions might play indirect roles in the pathomechanisms of human neurodegenerative and inflammatory diseases; these aspects are also summarized and discussed in this review.

Keywords: CsgA; DNA and RNA transactions; Hfq; RepA; TmaR; bacterial amyloids; biofilm; curli; extracellular DNA (eDNA); liquid–liquid phase separation (LLPS); nucleoid; small noncoding RNA (sRNA).

Figure 1

Summary of methodologies used to study bacterial amyloids and their interaction with nucleic acids. These include techniques that provide information of a global (nm) or local (Å) scale. X-ray crystallography and ssNMR analysis of amyloid peptides can provide detailed three-dimensional information regarding structural organization at the atomic level. Molecular imaging using AFM and TEM can reveal the structures of fibers on a flat surface on a nm scale. Recent advances in cryo-EM even allow one to reach the Å-scale. Using small angle X-ray or neutron scattering (SAXS/SANS), the reflections corresponding to cross-β structure can be seen at ~0.7 and ~1.35 Å⁻¹, corresponding to inter-sheet and inter-strand distances of 8–10 Å and 4.7 Å. FTIR infrared spectroscopy reveals the structural features of protein secondary structures and nucleic acid conformations by monitoring bond vibrations (red line non amyloid, vs blue line amyloid, same for SRCD). Electron paramagnetic resonance (EPR) relies on interactions between unpaired electrons and an external magnetic field, and using paramagnetic tags attached to amyloid fibrils, information about flexibility and rigidity can be ascertained. Spectra from synchrotron radiation circular dichroism (SRCD) can inform aspects of β-sheets secondary structure as well as the specifics of nucleic acid conformation.

Figure 2

Structural predictions using webservers of three distinct IA-based programs. The structure of seven CsgA monomers was generated using (A) AlphaFold 3, (B) Chai-1, and (C) Protenix. Each monomer is presented with a different color. The structure of seven CsgA monomers in interaction with two monomers of DNA was generated using (D) AlphaFold 3, (E) Chai-1, and (F) Protenix. The DNA sequence used was a non-methylated CpG-containing duplex [118], namely GCCAACGGTGGCGCCAACGGTGGC (PDB ID 3QMG).

Figure 3

Amyloid-Driven Nucleic Acid Interaction Network in Bacteria. Recent discoveries have highlighted the significant roles bacterial amyloids play through their interactions with nucleic acids. These interactions affect both cellular regulation and structural organization. RepA and Hfq amyloid proteins control replication/plasmid copy number and DNA can induce amyloidogenicity. Similarly, extracellular DNA (eDNA) has been implicated in promoting amyloid formation in bacterial biofilms, particularly with curli fibers in pathogenic bacteria. Conversely, amyloids influence curli expression and biofilm formation. Bacterial amyloids also interact with RNA, as demonstrated with proteins like Rho, CarD, HelD, TmaR, and Hfq, impacting gene expression. Hfq indeed exemplifies the dual nucleic acid-binding capacity of bacterial amyloids, influencing both RNA and DNA structure and function via its C-terminal amyloid domain. Collectively, these findings underscore the multifaceted regulatory and structural roles of amyloid-like assemblies in bacterial cells. The RNAs are shown as black arrows and DNA as grey double helices; 5’ and 3’ ends of the mRNA are depicted by a “ball and arrowhead”, respectively; positive and negative regulations are indicated by green arrows and red T-shape symbols, respectively; double blue arrow indicates a physical interaction with another protein; dotted line symbolizes peptidoglycan (PG) between outer (OM) and inner (IM) membranes.