Redox control of antibiotic biosynthesis

Abstract

Streptomyces bacteria make diverse specialized metabolites that form the basis of ~55% of clinically used antibiotics. Despite this, only 3% of their encoded specialized metabolites have been matched to molecules, and understanding how their biosynthesis is controlled is essential to fully exploit their potential. Here, we use Streptomyces formicae and the formicamycin biosynthetic pathway as a model to understand the complex regulation of specialized metabolism. We analyzed all three pathway-specific regulators and found that biosynthesis is subject to negative feedback and redox control via two MarR-family proteins, while activation of the pathway is dependent on a cytoplasmic two-component system. Like many Streptomyces antibiotics, formicamycins are only produced in solid culture, and biosynthesis is switched off in aerated liquid cultures. Here, we demonstrate that a redox-sensitive repressor named ForJ senses oxygen via a single cysteine residue that is required to repress formicamycin biosynthesis in liquid cultures.IMPORTANCEAntimicrobial resistance presents a significant threat to human health. Streptomyces bacteria are a promising source of novel antimicrobials; however, encouraging production of these molecules under laboratory conditions remains a challenge because we have limited understanding of the signals that control their production. Here, we use the formicamycin producer, Streptomyces formicae, as a model to further understand how antibiotic production is regulated in response to various signals. We show that three regulatory elements work together to coordinate formicamycin biosynthesis in response to intracellular signals, redox stress, and formicamycin accumulation. We also show that by making the regulators "blind" to these signals, we can induce high-level production of formicamycins in industrially relevant conditions, which facilitates their development as new antimicrobials.

Keywords: Streptomyces; natural products; regulation.

Fig 1

ForGF acts as a classical two-component system to activate formicamycin biosynthesis. Deletion of either forF or forG individually, or the entire forGF operon, abolishes formicamycin production, which can be restored by complementation in trans under the native forGF operon promoter. Changing the conserved histidine residue of ForG (H175) or the conserved aspartate residue of ForF (D53) to an alanine via either in trans complementation or introduction of point mutations directly into the native chromosomal alleles by gene editing (p.) results in a near total loss of biosynthesis. Changing the D53 of ForF to a glutamate residue by gene editing (p.) appears to mimic the phosphorylated D53 residue and restore formicamycin biosynthesis (n = 4, err = SD). *** = P < 0.0001, ns = P > 0.05.

Fig 2

ForF binds to a 12 base pair DNA sequence at just three sites on the S. formicae genome. (A) ForF binds to a single site between the divergent forHI and forGF operons. (B) ForF binds to two sites upstream of the KY5_0375 gene. Inset: a consensus sequence generated by aligning these three binding sites. Distances between the start of the coding regions, promoters, and binding sites are scaled (n = 3, error = SD).

Fig 3

ForZ binds an imperfect inverted repeat to repress expression of forAA. ForZ specifically binds to an 8 base pair palindromic repeat sequence between the divergent forZ and forAA genes in a concentration-dependent manner, where the underlined A is the TSS of forAA. Distances between the start of the coding regions, promoters, and binding sites are scaled (n = 3, error = SD).

Fig 4

ForZ binding to DNA is abolished by the addition of formicamycin I. (A) SPR was used to measure the interaction of a double-stranded DNA probe containing the inverted repeat sequence (ATTAGCTCGAAGTTCGATGCATCTTGCAGT) with increasing concentrations of ForZ protein. ForZ binds to DNA with a K_D of 46 nM (Fig. S3). Addition of 10 µM formicamycin I abolished the activity of ForZ to bind to DNA, and the same concentration of fasamycin E reduces binding to approximately 50% (n = 2). (B) Titrating increasing concentrations of formicamycin I onto 500 nM ForZ shows that formicamycin I inhibits ForZ binding to DNA with an IC₅₀ of 2.48 µM (n = 4, error = SD).

Fig 5

ForJ binds upstream of several biosynthetic genes in the for BGC. ForJ binds specific sequences within the promoters of forM, forJ, and forT in the presence of 1 mM DTT, and alignment of the binding sites identified a 14 bp consensus site (inset). The site appears twice, back-to-back, in the promoter of forM. Binding at the forT/U promoter was tested three times at three concentrations, whereas binding at the other sites was tested twice. Previous work shows binding of ForJ to these promoter regions inhibits gene expression (8), likely because ForJ blocks access to their TSS (underlined). Distances between the start of the coding region, promoters, and binding sites are scaled.

Fig 6

ForJ forms dimers-of-dimers in oxidizing conditions in vitro. (A) Top: AlphaFold 3 model of a wild-type ForJ dimer, with the monomers in blue and orange. Visualized in ChimeraX. Bottom: AlphaFold model of the C68S variant dimer (red) overlaid with the wild type (blue), suggesting the cysteine residue (yellow) is not essential for protein folding. Note that C68 is predicted to be in the DNA-binding domain of ForJ, but in dimeric ForJ, the cysteines are facing in opposite directions. Visualized in ChimeraX. (B) AlphaFold 3 model of wild-type ForJ dimer of dimers. This suggests that on oxidation, two dimers of ForJ could tightly wrap around the DNA, providing strong repression of gene expression. (C) Analysis by non-denaturing SDS-PAGE shows that the size of ForJ increases upon exposure to hydrogen peroxide, consistent with a dimer of dimers (76 kDa) formed by oxidation of the cysteine residues, but it forms single dimers (38 kDa) and monomers (19 kDa) in the presence of the reducing agent DTT. (D) ReFeyn mass photometry shows that in the absence of a reducing agent, native ForJ is present in two states: 38 kDa and 76 kDa. Reduction by Tris(2-carboxyethyl)phosphine (TCEP) keeps the majority of the sample at 38 kDa, the expected size of a ForJ dimer. Mass photometry experiments were run by Colin Grant, ReFeyn Ltd., Oxford.

Fig 7

Growing S. formicae under oxidizing conditions results in downregulation of the for BGC and a decrease in formicamycin production. Addition of 0.5 mM diamide to the solid growth medium downregulates expression of for BGC transcripts encoding the biosynthetic and export machinery (n = 4, error = SD).

Fig 8

The oxidation state of ForJ C68 controls the expression levels of the for BGC. (A) In liquid culture, qRT-PCR data show that, with the exception of forZ, expression of the for BGC is increased in both a forJ deletion mutant and the ForJ C68S mutant compared to the wild type (n = 3, error = SD). (B) Fasamycin and formicamycin congeners are only produced in liquid cultures of S. formicae ∆forJ and S. formicae ForJ C68S, where the native forJ allele has been mutated (n = 4, error = SD), and not in the wild-type strain. This suggests the oxidation state of C68 is important for determining whether the pathway is on or off during liquid culture.

Fig 9

Increased formicamycin biosynthesis is associated with increased production of stress response proteins. Removing the redox-sensitive repressor ForJ (∆forJ) results in significant upregulation of proteins from the formicamycin biosynthetic pathway, as well as stress-response proteins such as those involved in proteolysis. This is consistent with an oxidative-stress response being triggered. In contrast, competing biosynthetic pathways such as PKSs and siderophores, membrane components, and cell division proteins are downregulated.

Fig 10

An overview of cluster-situated regulatory control of formicamycin biosynthesis by ForJ (repressor), ForGF (activator), and ForZ (export). Under reducing conditions, ForJ is bound as a dimer to multiple biosynthetic promoters, providing weak repression of the pathway. ForZ is bound to the divergent pforZ-AA promoters, repressing expression of the export pump. The kinase ForG senses an unknown intracellular signal and phosphorylates the response regulator, ForF. Once phosphorylated, ForF binds a consensus sequence in the divergent pforHI-GF promoters to activate formicamycin biosynthesis. Once formicamycins begin to accumulate, ForZ repression of forAA is lifted, allowing for the compounds to be exported from the cell. Increased formicamycin biosynthesis results in the accumulation of hypochlorous acid (HOCl) and peroxy species. Oxidation of a cysteine residue in ForJ results in inter-dimer disulfide bonds forming, resulting in the formation of a dimer of dimers that represses more strongly. Together, these regulators ensure formicamycin biosynthesis and export occur at an optimal rate.