Identification and Validation of Inverse Agonists for Nuclear Receptor Subfamily 4 Group A Member 2

Abstract

Former studies indicate that nuclear receptor subfamily 4 group A member 2 (Nurr1, NR4A2), a transcription factor, is regarded as a potential therapeutic target for central nervous system diseases, and many studies have focused on the development and optimization of agonists of Nurr1. Recent studies have shown that Nurr1 is upregulated in many other diseases. However, there is still a lack of effective inverse Nurr1 agonists as a therapeutic strategy or as pharmacological tools to counteract the receptor's inherent activity. In this study, we screened Nurr1 ligands through a high-throughput screening system and identified a novel Nurr1 inverse agonist (K-strophanthoside). We further validated the binding site of K-strophanthoside on Nurr1 and investigated its effect on regulating Nurr1 function. K-strophanthoside directly binds to the ligand-binding domain of Nurr1 (Glu445, Glu514, Arg515, and His516) and mimics the function of Nurr1 knockdown by suppressing the intrinsic Nurr1 transcriptional activity. Our study contributes a valuable chemical tool for Nurr1 modulators and provides a potential treatment target for Nurr1-related disorders.

1

Binding model of K-strophanthoside to the Nurr1 protein. (A) Two-dimensional binding pattern of K-strophanthoside to the Nurr1 protein (PDB code: 6DDA). (B) Three-dimensional binding mode of K-strophanthoside to Nurr1-LBD. K-strophanthoside is shown as a yellow rod. The surrounding residues in the binding bag are green. Hydrogen bonds are represented by the dotted red line. (C) Electrostatic surface rendering of K-strophanthoside with Nurr-LBD. Blue and red surfaces indicate positively and negatively charged surfaces, respectively. K-strophanthoside is shown as a yellow rod. (D) Effects of Nurr1 mutations in the potential K-strophanthoside binding sites on the transcriptional activity of Nurr1. The transcriptional activity of wild-type (WT) and mutant constructs (E445A, L509A, E514A, R515A, and H516A) was examined by luciferase reporter assay with or without K-strophanthoside (100 μM). *P < 0.05, **P < 0.01. Data are mean ± S.E.M., n ≥ 3, one-way ANOVA in comparison expression with control (WT-Nurr1).

2

Binding between Nurr1 and small-molecule compounds was determined by SPR. The Nurr1 protein was coupled to a CM5 chip and exposed to samples at various doses. (A) Concentration-dependent binding of AQ to Nurr1. AQ was injected at increasing doses (1.953, 3.906, 7.813, 15.63, 31.25, 62.5, and 125 μM). (B) Steady-state affinity fitting diagram of AQ binding with Nurr1. (C) Concentration-dependent binding of K-strophanthoside to Nurr1. K-strophanthoside was injected at increasing doses (3.906, 7.813, 15.63, 31.25, 62.5, 125, and 250 μM). The black curves represent the fitting lines.

3

Biological effects of K-strophanthoside in Neuro-2a cells. (A–D) Impact of K-strophanthoside on Nurr1 and Nurr1-associated gene (TH and AADC) protein expression in Neuro-2a cells for 24 h. (E) Effect of K-strophanthoside on Nurr1-associated gene mRNA expression of TH and AADC at a concentration of 30 μM. (F, G) Fluorescence intensity of TH and AADC was detected by immunofluorescence after administration of K-strophanthoside. *P < 0.05, **P < 0.01. Data are mean ± S.E.M., n ≥ 3, one-way ANOVA in comparison expression with 0 μM compound (DMSO only) in Western blot analysis, t-test in comparison expression with 0 μM compound (DMSO only) in real-time PCR analysis.

4

Integrated identification and enrichment analysis of DEGs obtained from Nurr1 knockdown cells and K-strophanthoside-treated cells at 30 μM. (A, B) Volcano plots for DEGs from Nurr1 knockdown cells (A) and K-strophanthoside-treated cells (B). Red and blue dots represent upregulated genes (q-value < 0.05 and log2FC ≥ 0.58) and downregulated genes (q-value < 0.05 and log2FC ≤ −0.58), respectively. (C) Venn map of DEGs indicates common upregulated and downregulated DEGs between Nurr1 knockdown cells and K-strophanthoside-treated cells. (D–F) Top 3 GO enrichment pathways of commonly changed DEGs in three functional groups: Biological process (D), cellular component (E), and molecular function (F). (G–H) Bubble diagram of the top 3 KEGG enrichment pathways for common upregulated DEGs (G) and common downregulated DEGs (H). DEGs, differentially expressed genes.

5

Construction of luciferase reporter gene plasmids and luciferase reporter gene assays for Nurr1 modulation by small-molecule compounds. (A) DNA response elements for the human Nurr1 monomer (NBRE, AAGGTCACAAGGTCACAAGGTCACAAGGTCAC), the Nurr1 homodimer (NurRE, TGATATTTACCTCCAAATGCCA), or the Nurr1-RXR heterodimer (DR5, GGTTCACCGAAAGGTCA) were fused into pGL3-Basic vector to generate transgenic luciferase reporter gene plasmids. (B–D) Full-length Nurr1 reporter gene assays with human Nurr1 response elements in HEK293T cells for 24 h: (B) NBRE for the Nurr1 monomer, (C) NurRE for the Nurr1 homodimer, (D) DR5 for the Nurr1/RXRα heterodimer. (E) Transcriptional activity profiles of small-molecule compounds (100 μM) on Nurr1 modulation compared with the control group. *P < 0.05. Data are mean ± S.E.M., n ≥ 3, one-way ANOVA in comparison expression with 0 μM compound.