Plasmids containing many tandem copies of a synthetic lactose operator

Abstract

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.